EMAIL THIS PAGE TO A FRIEND

PRDM9

PR domain containing 9

69 Gene Product Result for
Synonyms: MEISETZ MSBP3 PFM6 PRMD9 ZNF899
UniProtKB ID: Q9NQV7, B4DX22, Q27Q50
Gene ID:
Human(56979) Summary: The PR domain is a protein-protein interaction module of about 100 amino acids. PR domain-containing proteins, such as PRDM9, are often involved in transcriptional regulation (Jiang and Huang, 2000 [PubMed 10668202]
Mouse(213389) PR domain containing 9
Rat(365155) PR domain containing 9
Zebrafish(393876) PR domain containing 9
cow(100190914) PR domain containing 9
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020227 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020227 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020227 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144809 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144809 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144809 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU113641 MISSION® esiRNA esiRNA human PRDM9 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020227 Rosetta Predictions human pricing
NM_001108903 Rosetta Predictions rat pricing
XM_619431 Rosetta Predictions mouse pricing
XM_899365 Rosetta Predictions mouse pricing
XM_911812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020227 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00245903 predicted 2529
2 SASI_Hs01_00245905 predicted 1768
3 SASI_Hs02_00353172 predicted 578
4 SASI_Hs01_00245908 predicted 2799
5 SASI_Hs02_00353173 predicted 587
6 SASI_Hs01_00245909 predicted 2808
7 SASI_Hs01_00245902 predicted 2903
8 SASI_Hs02_00353174 predicted 571
9 SASI_Hs01_00245904 predicted 278
10 SASI_Hs01_00245906 predicted 254
11 SASI_Hs01_00245907 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108903 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243225 predicted 726
2 SASI_Rn02_00243226 predicted 554
3 SASI_Rn02_00243227 predicted 719
4 SASI_Rn02_00243228 predicted 785
5 SASI_Rn02_00243229 predicted 1165
6 SASI_Rn02_00243230 predicted 539
7 SASI_Rn02_00243231 predicted 534
8 SASI_Rn02_00243232 predicted 1007
9 SASI_Rn02_00243233 predicted 816
10 SASI_Rn02_00243234 predicted 771
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619431 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427399 predicted 1813
2 SASI_Mm02_00427400 predicted 2417
3 SASI_Mm02_00427401 predicted 1833
4 SASI_Mm02_00427402 predicted 493
5 SASI_Mm02_00427403 predicted 399
6 SASI_Mm02_00427404 predicted 624
7 SASI_Mm02_00427405 predicted 625
8 SASI_Mm02_00427406 predicted 1814
9 SASI_Mm02_00427407 predicted 1806
10 SASI_Mm02_00427408 predicted 462
11 SASI_Mm01_00216331 predicted 1076
12 SASI_Mm01_00216332 predicted 1211
13 SASI_Mm01_00216333 predicted 1221
14 SASI_Mm01_00216334 predicted 1111
15 SASI_Mm01_00216335 predicted 1155
16 SASI_Mm01_00216336 predicted 1158
17 SASI_Mm01_00216337 predicted 1100
18 SASI_Mm01_00216338 predicted 1078
19 SASI_Mm01_00216339 predicted 1104
20 SASI_Mm01_00216340 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899365 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236852 predicted 603
2 SASI_Mm01_00236853 predicted 724
3 SASI_Mm01_00236854 predicted 742
4 SASI_Mm01_00236855 predicted 633
5 SASI_Mm01_00236856 predicted 674
6 SASI_Mm01_00236857 predicted 685
7 SASI_Mm01_00236858 predicted 623
8 SASI_Mm01_00236859 predicted 595
9 SASI_Mm01_00236860 predicted 622
10 SASI_Mm01_00236861 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_911812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436655 predicted 1178
2 SASI_Mm02_00436656 predicted 1473
3 SASI_Mm02_00436657 predicted 1811
4 SASI_Mm02_00436658 predicted 874
5 SASI_Mm02_00436659 predicted 1836
6 SASI_Mm02_00436660 predicted 876
7 SASI_Mm02_00436661 predicted 494
8 SASI_Mm02_00436662 predicted 630
9 SASI_Mm02_00436663 predicted 889
10 SASI_Mm02_00436664 predicted 1141
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020227
PRDM9 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-580s21c1
Sequence:CCGGTGTCAAGAACAGCAAATTTACCTCGAGGTAAATTTGCTGTTCTTGACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-708s1c1
Sequence:CCGGGCAGCAATATCCAGATCCACACTCGAGTGTGGATCTGGATATTGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-2004s1c1
Sequence:CCGGCGATAGGTCAAGCCTCTGCTACTCGAGTAGCAGAGGCTTGACCTATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-983s1c1
Sequence:CCGGGACAAGGTTTCAGTGTTAAATCTCGAGATTTAACACTGAAACCTTGTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000016807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-1753s1c1
Sequence:CCGGGATAAGTCAAACCTCCTCAGTCTCGAGACTGAGGAGGTTTGACTTATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-1506s21c1
Sequence:CCGGCCAGATCCACACAGCCGTAATCTCGAGATTACGGCTGTGTGGATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-2532s21c1
Sequence:CCGGGGCTTTAGAGATAAGTCAAACCTCGAGGTTTGACTTATCTCTAAAGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-504s21c1
Sequence:CCGGTTAAGAGTGGAACAGCGTAAACTCGAGTTTACGCTGTTCCACTCTTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020227
PRDM9 MISSION shRNA shRNA Plasmid DNA
PR domain containing 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-580s21c1
Sequence:CCGGTGTCAAGAACAGCAAATTTACCTCGAGGTAAATTTGCTGTTCTTGACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-708s1c1
Sequence:CCGGGCAGCAATATCCAGATCCACACTCGAGTGTGGATCTGGATATTGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-2004s1c1
Sequence:CCGGCGATAGGTCAAGCCTCTGCTACTCGAGTAGCAGAGGCTTGACCTATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-983s1c1
Sequence:CCGGGACAAGGTTTCAGTGTTAAATCTCGAGATTTAACACTGAAACCTTGTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-1753s1c1
Sequence:CCGGGATAAGTCAAACCTCCTCAGTCTCGAGACTGAGGAGGTTTGACTTATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-1506s21c1
Sequence:CCGGCCAGATCCACACAGCCGTAATCTCGAGATTACGGCTGTGTGGATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-2532s21c1
Sequence:CCGGGGCTTTAGAGATAAGTCAAACCTCGAGGTTTGACTTATCTCTAAAGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-504s21c1
Sequence:CCGGTTAAGAGTGGAACAGCGTAAACTCGAGTTTACGCTGTTCCACTCTTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020227
PRDM9 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-580s21c1
Sequence:CCGGTGTCAAGAACAGCAAATTTACCTCGAGGTAAATTTGCTGTTCTTGACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-708s1c1
Sequence:CCGGGCAGCAATATCCAGATCCACACTCGAGTGTGGATCTGGATATTGCTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-2004s1c1
Sequence:CCGGCGATAGGTCAAGCCTCTGCTACTCGAGTAGCAGAGGCTTGACCTATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-983s1c1
Sequence:CCGGGACAAGGTTTCAGTGTTAAATCTCGAGATTTAACACTGAAACCTTGTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000016807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020227.1-1753s1c1
Sequence:CCGGGATAAGTCAAACCTCCTCAGTCTCGAGACTGAGGAGGTTTGACTTATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367911    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-1506s21c1
Sequence:CCGGCCAGATCCACACAGCCGTAATCTCGAGATTACGGCTGTGTGGATCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-2532s21c1
Sequence:CCGGGGCTTTAGAGATAAGTCAAACCTCGAGGTTTGACTTATCTCTAAAGCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020227.2-504s21c1
Sequence:CCGGTTAAGAGTGGAACAGCGTAAACTCGAGTTTACGCTGTTCCACTCTTAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144809
PRDM9 MISSION shRNA Bacterial Glycerol Stock
PR domain containing 9
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-767s1c1
Sequence:CCGGCAGGATGATGACTATCTCTATCTCGAGATAGAGATAGTCATCATCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-906s1c1
Sequence:CCGGCTGGGCTAAGAATTAGTCCATCTCGAGATGGACTAATTCTTAGCCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-1054s1c1
Sequence:CCGGGCTGATTACCAAGGGAAGAAACTCGAGTTTCTTCCCTTGGTAATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-1169s1c1
Sequence:CCGGGCCTTTCAATATCACAGGAAACTCGAGTTTCCTGTGATATTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000085194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-633s1c1
Sequence:CCGGCCTCCCTTGAAGAAGGAAATACTCGAGTATTTCCTTCTTCAAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144809
PRDM9 MISSION shRNA shRNA Plasmid DNA
PR domain containing 9
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-767s1c1
Sequence:CCGGCAGGATGATGACTATCTCTATCTCGAGATAGAGATAGTCATCATCCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-906s1c1
Sequence:CCGGCTGGGCTAAGAATTAGTCCATCTCGAGATGGACTAATTCTTAGCCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-1054s1c1
Sequence:CCGGGCTGATTACCAAGGGAAGAAACTCGAGTTTCTTCCCTTGGTAATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-1169s1c1
Sequence:CCGGGCCTTTCAATATCACAGGAAACTCGAGTTTCCTGTGATATTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-633s1c1
Sequence:CCGGCCTCCCTTGAAGAAGGAAATACTCGAGTATTTCCTTCTTCAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144809
PRDM9 MISSION shRNA Lentiviral Transduction Particles
PR domain containing 9
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-767s1c1
Sequence:CCGGCAGGATGATGACTATCTCTATCTCGAGATAGAGATAGTCATCATCCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085197    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-906s1c1
Sequence:CCGGCTGGGCTAAGAATTAGTCCATCTCGAGATGGACTAATTCTTAGCCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085193    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-1054s1c1
Sequence:CCGGGCTGATTACCAAGGGAAGAAACTCGAGTTTCTTCCCTTGGTAATCAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-1169s1c1
Sequence:CCGGGCCTTTCAATATCACAGGAAACTCGAGTTTCCTGTGATATTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000085194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144809.1-633s1c1
Sequence:CCGGCCTCCCTTGAAGAAGGAAATACTCGAGTATTTCCTTCTTCAAGGGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)