EMAIL THIS PAGE TO A FRIEND

PRDX1

peroxiredoxin 1

83 Gene Product Result for
Synonyms: MSP23 NKEF-A NKEFA PAG PAGA PAGB PRX1 PRXI TDPX2
Gene ID:
Human(5052) Summary: This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in cells, and may contribute to the antiviral activity of CD8(+) T-cells. This protein may have a proliferative effect and play a role in cancer development or progression. Four transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jan 2011]
Mouse(18477) peroxiredoxin 1
Rat(117254) peroxiredoxin 1
Zebrafish(541344) peroxiredoxin 1
dog(475375) peroxiredoxin 1
domestic cat(101091216) peroxiredoxin 1
chicken(424598) peroxiredoxin 1
cow(281997) peroxiredoxin 1
sheep(101120966) peroxiredoxin 1
naked mole-rat(101709755) peroxiredoxin 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011034 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011034 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011034 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU111751 MISSION® esiRNA targeting human PRDX1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002574 Rosetta Predictions human pricing
NM_181696 Rosetta Predictions human pricing
NM_181697 Rosetta Predictions human pricing
NM_057114 Rosetta Predictions rat pricing
NM_011034 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119497 predicted 633 154.00
2 SASI_Hs01_00119499 predicted 701 154.00
3 SASI_Hs01_00119500 predicted 585 154.00
4 SASI_Hs02_00334069 predicted 740 154.00
5 SASI_Hs02_00334070 predicted 600 154.00
6 SASI_Hs02_00334071 predicted 598 154.00
7 SASI_Hs01_00119502 predicted 757 154.00
8 SASI_Hs01_00119503 predicted 592 154.00
9 SASI_Hs01_00119504 predicted 634 154.00
10 SASI_Hs02_00334072 predicted 639 154.00
11 SASI_Hs01_00119498 predicted 634 154.00
12 SASI_Hs01_00119501 predicted 694 154.00
13 SASI_Hs01_00119505 predicted 783 154.00
14 SASI_Hs01_00119506 predicted 554 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181696 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00049115 predicted 600 154.00
2 SASI_Hs01_00049117 predicted 671 154.00
3 SASI_Hs01_00049118 predicted 555 154.00
4 SASI_Hs02_00370289 predicted 715 154.00
5 SASI_Hs02_00370290 predicted 573 154.00
6 SASI_Hs02_00370291 predicted 566 154.00
7 SASI_Hs01_00049120 predicted 730 154.00
8 SASI_Hs01_00049121 predicted 569 154.00
9 SASI_Hs01_00049122 predicted 601 154.00
10 SASI_Hs02_00370292 predicted 611 154.00
11 SASI_Hs01_00049116 predicted 611 154.00
12 SASI_Hs01_00049119 predicted 669 154.00
13 SASI_Hs01_00049123 predicted 754 154.00
14 SASI_Hs01_00049124 predicted 531 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181697 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096924 predicted 411 154.00
2 SASI_Hs01_00096926 predicted 475 154.00
3 SASI_Hs01_00096927 predicted 367 154.00
4 SASI_Hs02_00370293 predicted 528 154.00
5 SASI_Hs02_00370294 predicted 374 154.00
6 SASI_Hs02_00370295 predicted 373 154.00
7 SASI_Hs01_00096929 predicted 540 154.00
8 SASI_Hs01_00096930 predicted 376 154.00
9 SASI_Hs01_00096931 predicted 412 154.00
10 SASI_Hs02_00370296 predicted 426 154.00
11 SASI_Hs01_00096925 predicted 411 154.00
12 SASI_Hs01_00096928 predicted 471 154.00
13 SASI_Hs01_00096932 predicted 564 154.00
14 SASI_Hs01_00096933 predicted 338 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057114 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083251 predicted 231 154.00
2 SASI_Rn01_00083252 predicted 343 154.00
3 SASI_Rn01_00083253 predicted 388 154.00
4 SASI_Rn01_00083254 predicted 311 154.00
5 SASI_Rn01_00083255 predicted 304 154.00
6 SASI_Rn01_00083257 predicted 269 154.00
7 SASI_Rn01_00083258 predicted 301 154.00
8 SASI_Rn01_00083260 predicted 593 154.00
9 SASI_Rn02_00267046 predicted 441 154.00
10 SASI_Rn02_00267047 predicted 441 154.00
11 SASI_Rn01_00083256 predicted 472 154.00
12 SASI_Rn01_00083259 predicted 628 154.00
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011034 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319767 predicted 371 154.00
2 SASI_Mm02_00319768 predicted 620 154.00
3 SASI_Mm02_00319769 predicted 250 154.00
4 SASI_Mm02_00319770 predicted 363 154.00
5 SASI_Mm02_00319771 predicted 243 154.00
6 SASI_Mm02_00319772 predicted 327 154.00
7 SASI_Mm02_00319773 predicted 258 154.00
8 SASI_Mm02_00319774 predicted 370 154.00
9 SASI_Mm02_00319775 predicted 419 154.00
10 SASI_Mm02_00319776 predicted 235 154.00
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002574
VALIDATED
PRDX1 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000029509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-636s1c1
Sequence:CCGGCCATGAACATTCCTTTGGTATCTCGAGATACCAAAGGAATGTTCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-800s1c1
Sequence:CCGGGATGAGACTTTGAGACTAGTTCTCGAGAACTAGTCTCAAAGTCTCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-404s1c1
Sequence:CCGGCCAGATGGTCAGTTTAAAGATCTCGAGATCTTTAAACTGACCATCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-512s1c1
Sequence:CCGGGCTTTCAGTGATAGGGCAGAACTCGAGTTCTGCCCTATCACTGAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000029510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-430s1c1
Sequence:CCGGCCTGTCTGACTACAAAGGAAACTCGAGTTTCCTTTGTAGTCAGACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002574
VALIDATED
PRDX1 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000029509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-636s1c1
Sequence:CCGGCCATGAACATTCCTTTGGTATCTCGAGATACCAAAGGAATGTTCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-800s1c1
Sequence:CCGGGATGAGACTTTGAGACTAGTTCTCGAGAACTAGTCTCAAAGTCTCATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-404s1c1
Sequence:CCGGCCAGATGGTCAGTTTAAAGATCTCGAGATCTTTAAACTGACCATCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-512s1c1
Sequence:CCGGGCTTTCAGTGATAGGGCAGAACTCGAGTTCTGCCCTATCACTGAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000029510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-430s1c1
Sequence:CCGGCCTGTCTGACTACAAAGGAAACTCGAGTTTCCTTTGTAGTCAGACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002574
VALIDATED
PRDX1 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000029509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-636s1c1
Sequence:CCGGCCATGAACATTCCTTTGGTATCTCGAGATACCAAAGGAATGTTCATGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029512    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-800s1c1
Sequence:CCGGGATGAGACTTTGAGACTAGTTCTCGAGAACTAGTCTCAAAGTCTCATCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-404s1c1
Sequence:CCGGCCAGATGGTCAGTTTAAAGATCTCGAGATCTTTAAACTGACCATCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-512s1c1
Sequence:CCGGGCTTTCAGTGATAGGGCAGAACTCGAGTTCTGCCCTATCACTGAAAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000029510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002574.2-430s1c1
Sequence:CCGGCCTGTCTGACTACAAAGGAAACTCGAGTTTCCTTTGTAGTCAGACAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011034
PRDX1 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000120690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-251s1c1
Sequence:CCGGCAGTGATAGAGCCGATGAATTCTCGAGAATTCATCGGCTCTATCACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-558s1c1
Sequence:CCGGGCCTTCCAGTTCACTGACAAACTCGAGTTTGTCAGTGAACTGGAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-246s1c1
Sequence:CCGGGCTTTCAGTGATAGAGCCGATCTCGAGATCGGCTCTATCACTGAAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-369s1c1
Sequence:CCGGCCCATGAACATTCCCTTAATACTCGAGTATTAAGGGAATGTTCATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011034
PRDX1 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000120690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-251s1c1
Sequence:CCGGCAGTGATAGAGCCGATGAATTCTCGAGAATTCATCGGCTCTATCACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-558s1c1
Sequence:CCGGGCCTTCCAGTTCACTGACAAACTCGAGTTTGTCAGTGAACTGGAAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-246s1c1
Sequence:CCGGGCTTTCAGTGATAGAGCCGATCTCGAGATCGGCTCTATCACTGAAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-369s1c1
Sequence:CCGGCCCATGAACATTCCCTTAATACTCGAGTATTAAGGGAATGTTCATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011034
PRDX1 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000120690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-251s1c1
Sequence:CCGGCAGTGATAGAGCCGATGAATTCTCGAGAATTCATCGGCTCTATCACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-558s1c1
Sequence:CCGGGCCTTCCAGTTCACTGACAAACTCGAGTTTGTCAGTGAACTGGAAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-246s1c1
Sequence:CCGGGCTTTCAGTGATAGAGCCGATCTCGAGATCGGCTCTATCACTGAAAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000120689    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011034.2-369s1c1
Sequence:CCGGCCCATGAACATTCCCTTAATACTCGAGTATTAAGGGAATGTTCATGGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???