EMAIL THIS PAGE TO A FRIEND

PRDX2

peroxiredoxin 2

124 Gene Product Result for
Synonyms: NKEF-B NKEFB PRP PRX2 PRXII PTX1 TDPX1 TPX1 TSA
Gene ID:
Human(7001) Summary: This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein plays an antioxidant protective role in cells, and it may contribute to the antiviral activity of CD8(+) T-cells. The crystal structure of this protein has been resolved to 2.7 angstroms. This protein prevents hemolytic anemia from oxidative stress by stabilizing hemoglobin, thus making this gene a therapeutic target for patients with hemolytic anemia. This protein may have a proliferative effect and play a role in cancer development or progression. Related pseudogenes have been identified on chromosomes 5, 6, 10 and 13. [provided by RefSeq, Mar 2013]
Mouse(21672) peroxiredoxin 2
Rat(29338) peroxiredoxin 2
naked mole-rat(101715599) peroxiredoxin 2
cow(286793) peroxiredoxin 2
sheep(100307046) peroxiredoxin 2
Zebrafish(791455) peroxiredoxin 2
domestic cat(101085863) peroxiredoxin 2
dog(484926) peroxiredoxin 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0562 AQUA Peptide TDEGIAY[R] human pricing
AQ0561 AQUA Peptide QITVNDLPVG[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005809 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005809 Rosetta Predictions human pricing
NM_181737 Rosetta Predictions human pricing
NM_181738 Rosetta Predictions human pricing
NM_017169 Rosetta Predictions rat pricing
NM_011563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340326 predicted 308
2 SASI_Hs02_00340327 predicted 508
3 SASI_Hs02_00340328 predicted 481
4 SASI_Hs02_00340329 predicted 562
5 SASI_Hs02_00340330 predicted 228
6 SASI_Hs02_00340331 predicted 567
7 SASI_Hs02_00340332 predicted 224
8 SASI_Hs02_00340333 predicted 481
9 SASI_Hs02_00340334 predicted 216
10 SASI_Hs02_00340335 predicted 202
11 SASI_Hs01_00128886 predicted 745
12 SASI_Hs01_00128887 predicted 752
13 SASI_Hs01_00128888 predicted 619
14 SASI_Hs01_00128889 predicted 719
15 SASI_Hs01_00128890 predicted 705
16 SASI_Hs01_00128891 predicted 691
17 SASI_Hs01_00128892 predicted 683
18 SASI_Hs01_00128893 predicted 686
19 SASI_Hs01_00128894 predicted 727
20 SASI_Hs01_00128895 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181737 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217779 predicted 592
2 SASI_Hs01_00217780 predicted 594
3 SASI_Hs01_00217781 predicted 471
4 SASI_Hs01_00217782 predicted 568
5 SASI_Hs01_00217783 predicted 557
6 SASI_Hs01_00217784 predicted 540
7 SASI_Hs01_00217785 predicted 531
8 SASI_Hs01_00217786 predicted 531
9 SASI_Hs01_00217787 predicted 574
10 SASI_Hs01_00217788 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370345 predicted 205
2 SASI_Hs02_00370346 predicted 217
3 SASI_Hs02_00370347 predicted 199
4 SASI_Hs02_00370348 predicted 197
5 SASI_Hs02_00370349 predicted 215
6 SASI_Hs02_00370350 predicted 198
7 SASI_Hs02_00370351 predicted 303
8 SASI_Hs01_00099361 predicted 619
9 SASI_Hs02_00370352 predicted 228
10 SASI_Hs01_00099363 predicted 157
11 SASI_Hs01_00099362 predicted 256
12 SASI_Hs01_00099364 predicted 624
13 SASI_Hs01_00099365 predicted 158
14 SASI_Hs01_00099366 predicted 610
15 SASI_Hs01_00099367 predicted 620
16 SASI_Hs01_00099368 predicted 362
17 SASI_Hs01_00099369 predicted 251
18 SASI_Hs01_00099370 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017169 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00111231 predicted 268
2 SASI_Rn01_00111232 predicted 620
3 SASI_Rn01_00111233 predicted 632
4 SASI_Rn01_00111234 predicted 265
5 SASI_Rn01_00111235 predicted 616
6 SASI_Rn01_00111237 predicted 613
7 SASI_Rn01_00111239 predicted 476
8 SASI_Rn01_00111240 predicted 521
9 SASI_Rn02_00261491 predicted 467
10 SASI_Rn02_00261492 predicted 475
11 SASI_Rn01_00111236 predicted 234
12 SASI_Rn01_00111238 predicted 237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320930 predicted 450
2 SASI_Mm02_00320931 predicted 689
3 SASI_Mm02_00320932 predicted 216
4 SASI_Mm02_00320933 predicted 660
5 SASI_Mm02_00320934 predicted 705
6 SASI_Mm02_00320935 predicted 196
7 SASI_Mm02_00320936 predicted 682
8 SASI_Mm02_00320937 predicted 449
9 SASI_Mm02_00320938 predicted 293
10 SASI_Mm02_00320939 predicted 682
11 SASI_Mm01_00053560 predicted 979
12 SASI_Mm01_00053561 predicted 1036
13 SASI_Mm01_00053562 predicted 1076
14 SASI_Mm01_00053563 predicted 482
15 SASI_Mm01_00053564 predicted 1033
16 SASI_Mm01_00053565 predicted 1044
17 SASI_Mm01_00053566 predicted 1030
18 SASI_Mm01_00053567 predicted 938
19 SASI_Mm01_00053568 predicted 481
20 SASI_Mm01_00053569 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011563
VALIDATED
PRDX2 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011563.2-216s1c1
Sequence:CCGGCCTTCAAGGAAATCAAGCTTTCTCGAGAAAGCTTGATTTCCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011563.2-1152s1c1
Sequence:CCGGGCTCTTTATGTTTCTCCTGAACTCGAGTTCAGGAGAAACATAAAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011563.2-467s1c1
Sequence:CCGGACTAAGAGCTTGTCACACAATCTCGAGATTGTGTGACAAGCTCTTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011563.2-466s1c1
Sequence:CCGGGACTAAGAGCTTGTCACACAACTCGAGTTGTGTGACAAGCTCTTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-424s21c1
Sequence:CCGGCTGCTTGCTGACGTGACTAAACTCGAGTTTAGTCACGTCAGCAAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-705s21c1
Sequence:CCGGACACAACTGAGATGGGTAAACCTCGAGGTTTACCCATCTCAGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011563.5-730s21c1
Sequence:CCGGGTGAGCCTGAAGCTTGGATTTCTCGAGAAATCCAAGCTTCAGGCTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-590s21c1
Sequence:CCGGTAGTCCAGGCCTTTCAGTATACTCGAGTATACTGAAAGGCCTGGACTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-188s21c1
Sequence:CCGGCCTTCAAGGAAATCAAGCTTTCTCGAGAAAGCTTGATTTCCTTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011563
VALIDATED
PRDX2 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011563.2-216s1c1
Sequence:CCGGCCTTCAAGGAAATCAAGCTTTCTCGAGAAAGCTTGATTTCCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011563.2-1152s1c1
Sequence:CCGGGCTCTTTATGTTTCTCCTGAACTCGAGTTCAGGAGAAACATAAAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011563.2-467s1c1
Sequence:CCGGACTAAGAGCTTGTCACACAATCTCGAGATTGTGTGACAAGCTCTTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011563.2-466s1c1
Sequence:CCGGGACTAAGAGCTTGTCACACAACTCGAGTTGTGTGACAAGCTCTTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-424s21c1
Sequence:CCGGCTGCTTGCTGACGTGACTAAACTCGAGTTTAGTCACGTCAGCAAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-705s21c1
Sequence:CCGGACACAACTGAGATGGGTAAACCTCGAGGTTTACCCATCTCAGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011563.5-730s21c1
Sequence:CCGGGTGAGCCTGAAGCTTGGATTTCTCGAGAAATCCAAGCTTCAGGCTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-590s21c1
Sequence:CCGGTAGTCCAGGCCTTTCAGTATACTCGAGTATACTGAAAGGCCTGGACTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000322454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-188s21c1
Sequence:CCGGCCTTCAAGGAAATCAAGCTTTCTCGAGAAAGCTTGATTTCCTTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011563
VALIDATED
PRDX2 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011563.2-216s1c1
Sequence:CCGGCCTTCAAGGAAATCAAGCTTTCTCGAGAAAGCTTGATTTCCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120692    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011563.2-1152s1c1
Sequence:CCGGGCTCTTTATGTTTCTCCTGAACTCGAGTTCAGGAGAAACATAAAGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011563.2-467s1c1
Sequence:CCGGACTAAGAGCTTGTCACACAATCTCGAGATTGTGTGACAAGCTCTTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120695    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011563.2-466s1c1
Sequence:CCGGGACTAAGAGCTTGTCACACAACTCGAGTTGTGTGACAAGCTCTTAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-424s21c1
Sequence:CCGGCTGCTTGCTGACGTGACTAAACTCGAGTTTAGTCACGTCAGCAAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322457    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-705s21c1
Sequence:CCGGACACAACTGAGATGGGTAAACCTCGAGGTTTACCCATCTCAGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322526    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011563.5-730s21c1
Sequence:CCGGGTGAGCCTGAAGCTTGGATTTCTCGAGAAATCCAAGCTTCAGGCTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322456    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-590s21c1
Sequence:CCGGTAGTCCAGGCCTTTCAGTATACTCGAGTATACTGAAAGGCCTGGACTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000322454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011563.5-188s21c1
Sequence:CCGGCCTTCAAGGAAATCAAGCTTTCTCGAGAAAGCTTGATTTCCTTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005809
VALIDATED
PRDX2 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-232s1c1
Sequence:CCGGGTGAAGCTGTCGGACTACAAACTCGAGTTTGTAGTCCGACAGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-561s1c1
Sequence:CCGGCCTTCGCCAGATCACTGTTAACTCGAGTTAACAGTGATCTGGCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005809.4-534s1c1
Sequence:CCGGCCTCTTTATCATCGATGGCAACTCGAGTTGCCATCGATGATAAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-681s1c1
Sequence:CCGGGCCTGGCAGTGACACGATTAACTCGAGTTAATCGTGTCACTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-474s1c1
Sequence:CCGGCAGACGCTTGTCTGAGGATTACTCGAGTAATCCTCAGACAAGCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-561s21c1
Sequence:CCGGCCTTCGCCAGATCACTGTTAACTCGAGTTAACAGTGATCTGGCGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-474s21c1
Sequence:CCGGCAGACGCTTGTCTGAGGATTACTCGAGTAATCCTCAGACAAGCGTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-232s21c1
Sequence:CCGGGTGAAGCTGTCGGACTACAAACTCGAGTTTGTAGTCCGACAGCTTCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-681s21c1
Sequence:CCGGGCCTGGCAGTGACACGATTAACTCGAGTTAATCGTGTCACTGCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005809
VALIDATED
PRDX2 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-232s1c1
Sequence:CCGGGTGAAGCTGTCGGACTACAAACTCGAGTTTGTAGTCCGACAGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-561s1c1
Sequence:CCGGCCTTCGCCAGATCACTGTTAACTCGAGTTAACAGTGATCTGGCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005809.4-534s1c1
Sequence:CCGGCCTCTTTATCATCGATGGCAACTCGAGTTGCCATCGATGATAAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-681s1c1
Sequence:CCGGGCCTGGCAGTGACACGATTAACTCGAGTTAATCGTGTCACTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000064905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-474s1c1
Sequence:CCGGCAGACGCTTGTCTGAGGATTACTCGAGTAATCCTCAGACAAGCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-561s21c1
Sequence:CCGGCCTTCGCCAGATCACTGTTAACTCGAGTTAACAGTGATCTGGCGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-474s21c1
Sequence:CCGGCAGACGCTTGTCTGAGGATTACTCGAGTAATCCTCAGACAAGCGTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-232s21c1
Sequence:CCGGGTGAAGCTGTCGGACTACAAACTCGAGTTTGTAGTCCGACAGCTTCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000300132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-681s21c1
Sequence:CCGGGCCTGGCAGTGACACGATTAACTCGAGTTAATCGTGTCACTGCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005809
VALIDATED
PRDX2 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-232s1c1
Sequence:CCGGGTGAAGCTGTCGGACTACAAACTCGAGTTTGTAGTCCGACAGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064903    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-561s1c1
Sequence:CCGGCCTTCGCCAGATCACTGTTAACTCGAGTTAACAGTGATCTGGCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005809.4-534s1c1
Sequence:CCGGCCTCTTTATCATCGATGGCAACTCGAGTTGCCATCGATGATAAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-681s1c1
Sequence:CCGGGCCTGGCAGTGACACGATTAACTCGAGTTAATCGTGTCACTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000064905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005809.4-474s1c1
Sequence:CCGGCAGACGCTTGTCTGAGGATTACTCGAGTAATCCTCAGACAAGCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-561s21c1
Sequence:CCGGCCTTCGCCAGATCACTGTTAACTCGAGTTAACAGTGATCTGGCGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-474s21c1
Sequence:CCGGCAGACGCTTGTCTGAGGATTACTCGAGTAATCCTCAGACAAGCGTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300193    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-232s21c1
Sequence:CCGGGTGAAGCTGTCGGACTACAAACTCGAGTTTGTAGTCCGACAGCTTCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000300132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005809.4-681s21c1
Sequence:CCGGGCCTGGCAGTGACACGATTAACTCGAGTTAATCGTGTCACTGCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)