EMAIL THIS PAGE TO A FRIEND

PRDX5

peroxiredoxin 5

120 Gene Product Result for
Synonyms: ACR1 AOEB166 B166 PLP PMP20 PRDX6 PRXV prx-V
Gene ID:
Human(25824) Summary: This gene encodes a member of the peroxiredoxin family of antioxidant enzymes, which reduce hydrogen peroxide and alkyl hydroperoxides. The encoded protein may play an antioxidant protective role in different tissues under normal conditions and during inflammatory processes. This protein interacts with peroxisome receptor 1. The crystal structure of this protein in its reduced form has been resolved to 1.5 angstrom resolution. This gene uses alternate in-frame translation initiation sites to generate mitochondrial or peroxisomal/cytoplasmic forms. Three transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(54683) peroxiredoxin 5
Rat(113898) peroxiredoxin 5
Zebrafish(554105) peroxiredoxin 5
dog(476032) peroxiredoxin 5
domestic cat(101093462) peroxiredoxin 5
cow(282885) peroxiredoxin 5
sheep(101103521) peroxiredoxin 5
Goat(100861117) peroxiredoxin 5
naked mole-rat(101723253) peroxiredoxin 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012021 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_012021 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_012021 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012094 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012094 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012094 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012094 Rosetta Predictions human pricing
NM_181651 Rosetta Predictions human pricing
NM_181652 Rosetta Predictions human pricing
NM_053610 Rosetta Predictions rat pricing
NM_012021 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012094 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072985 predicted 602
2 SASI_Hs01_00072986 predicted 592
3 SASI_Hs02_00343596 predicted 485
4 SASI_Hs01_00072988 predicted 493
5 SASI_Hs01_00072989 predicted 642
6 SASI_Hs01_00072990 predicted 418
7 SASI_Hs01_00072991 predicted 362
8 SASI_Hs01_00072992 predicted 593
9 SASI_Hs01_00072993 predicted 591
10 SASI_Hs01_00072994 predicted 644
11 SASI_Hs01_00072987 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186377 predicted 462
2 SASI_Hs01_00186378 predicted 346
3 SASI_Hs01_00186379 predicted 459
4 SASI_Hs01_00186381 predicted 514
5 SASI_Hs01_00186382 predicted 366
6 SASI_Hs01_00186383 predicted 462
7 SASI_Hs01_00186384 predicted 464
8 SASI_Hs01_00186385 predicted 197
9 SASI_Hs01_00186386 predicted 522
10 SASI_Hs02_00370225 predicted 507
11 SASI_Hs01_00186380 predicted 496
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181652 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097788 predicted 326
2 SASI_Hs01_00097791 predicted 326
3 SASI_Hs02_00370226 predicted 197
4 SASI_Hs01_00097794 predicted 373
5 SASI_Hs01_00097797 predicted 325
6 SASI_Hs02_00370227 predicted 203
7 SASI_Hs02_00370228 predicted 325
8 SASI_Hs02_00370229 predicted 196
9 SASI_Hs02_00370230 predicted 379
10 SASI_Hs02_00370231 predicted 372
11 SASI_Hs01_00097789 predicted 149
12 SASI_Hs01_00097790 predicted 400
13 SASI_Hs01_00097792 predicted 354
14 SASI_Hs01_00097793 predicted 575
15 SASI_Hs01_00097795 predicted 477
16 SASI_Hs01_00097796 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039233 predicted 542
2 SASI_Rn01_00039234 predicted 219
3 SASI_Rn01_00039235 predicted 394
4 SASI_Rn01_00039236 predicted 506
5 SASI_Rn01_00039237 predicted 510
6 SASI_Rn01_00039238 predicted 367
7 SASI_Rn01_00039240 predicted 512
8 SASI_Rn01_00039241 predicted 406
9 SASI_Rn02_00266312 predicted 242
10 SASI_Rn01_00039242 predicted 581
11 SASI_Rn01_00039239 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012021 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031255 predicted 197
2 SASI_Mm01_00031256 predicted 201
3 SASI_Mm01_00031258 predicted 323
4 SASI_Mm01_00031260 predicted 382
5 SASI_Mm01_00031261 predicted 386
6 SASI_Mm01_00031262 predicted 294
7 SASI_Mm02_00321974 predicted 392
8 SASI_Mm02_00321975 predicted 378
9 SASI_Mm02_00321976 predicted 350
10 SASI_Mm02_00321977 predicted 223
11 SASI_Mm01_00031253 predicted 379
12 SASI_Mm01_00031254 predicted 345
13 SASI_Mm01_00031257 predicted 385
14 SASI_Mm01_00031259 predicted 258
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012021
VALIDATED
PRDX5 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-532s21c1
Sequence:CCGGCTTTGGGAATCGTCGGCTGAACTCGAGTTCAGCCGACGATTCCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-494s21c1
Sequence:CCGGGCGACAGACTTATTATTGGATCTCGAGATCCAATAATAAGTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-300s21c1
Sequence:CCGGCATTTACACCTGGCTGTTCTACTCGAGTAGAACAGCCAGGTGTAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-300s1c1
Sequence:CCGGCATTTACACCTGGCTGTTCTACTCGAGTAGAACAGCCAGGTGTAAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-76s1c1
Sequence:CCGGGCTCCGTGCATCGACGTGCTTCTCGAGAAGCACGTCGATGCACGGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-392s21c1
Sequence:CCGGCTGAGCGTTAATGACGTCTTTCTCGAGAAAGACGTCATTAACGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-392s1c1
Sequence:CCGGCTGAGCGTTAATGACGTCTTTCTCGAGAAAGACGTCATTAACGCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-494s1c1
Sequence:CCGGGCGACAGACTTATTATTGGATCTCGAGATCCAATAATAAGTCTGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-532s1c1
Sequence:CCGGCTTTGGGAATCGTCGGCTGAACTCGAGTTCAGCCGACGATTCCCAAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012021
VALIDATED
PRDX5 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-532s21c1
Sequence:CCGGCTTTGGGAATCGTCGGCTGAACTCGAGTTCAGCCGACGATTCCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-494s21c1
Sequence:CCGGGCGACAGACTTATTATTGGATCTCGAGATCCAATAATAAGTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-300s21c1
Sequence:CCGGCATTTACACCTGGCTGTTCTACTCGAGTAGAACAGCCAGGTGTAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-300s1c1
Sequence:CCGGCATTTACACCTGGCTGTTCTACTCGAGTAGAACAGCCAGGTGTAAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-76s1c1
Sequence:CCGGGCTCCGTGCATCGACGTGCTTCTCGAGAAGCACGTCGATGCACGGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000334335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-392s21c1
Sequence:CCGGCTGAGCGTTAATGACGTCTTTCTCGAGAAAGACGTCATTAACGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-392s1c1
Sequence:CCGGCTGAGCGTTAATGACGTCTTTCTCGAGAAAGACGTCATTAACGCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-494s1c1
Sequence:CCGGGCGACAGACTTATTATTGGATCTCGAGATCCAATAATAAGTCTGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000075467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-532s1c1
Sequence:CCGGCTTTGGGAATCGTCGGCTGAACTCGAGTTCAGCCGACGATTCCCAAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012021
VALIDATED
PRDX5 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-532s21c1
Sequence:CCGGCTTTGGGAATCGTCGGCTGAACTCGAGTTCAGCCGACGATTCCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334336    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-494s21c1
Sequence:CCGGGCGACAGACTTATTATTGGATCTCGAGATCCAATAATAAGTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-300s21c1
Sequence:CCGGCATTTACACCTGGCTGTTCTACTCGAGTAGAACAGCCAGGTGTAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-300s1c1
Sequence:CCGGCATTTACACCTGGCTGTTCTACTCGAGTAGAACAGCCAGGTGTAAATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-76s1c1
Sequence:CCGGGCTCCGTGCATCGACGTGCTTCTCGAGAAGCACGTCGATGCACGGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000334335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012021.2-392s21c1
Sequence:CCGGCTGAGCGTTAATGACGTCTTTCTCGAGAAAGACGTCATTAACGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-392s1c1
Sequence:CCGGCTGAGCGTTAATGACGTCTTTCTCGAGAAAGACGTCATTAACGCTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-494s1c1
Sequence:CCGGGCGACAGACTTATTATTGGATCTCGAGATCCAATAATAAGTCTGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000075467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_012021.1-532s1c1
Sequence:CCGGCTTTGGGAATCGTCGGCTGAACTCGAGTTCAGCCGACGATTCCCAAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012094
VALIDATED
PRDX5 MISSION shRNA Bacterial Glycerol Stock
peroxiredoxin 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-624s1c1
Sequence:CCGGCTGGTGTCCATCTTTGGGAATCTCGAGATTCCCAAAGATGGACACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-793s1c1
Sequence:CCGGCCTCCCTATCTCACCTGCCCACTCGAGTGGGCAGGTGAGATAGGGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-693s1c1
Sequence:CCGGGCCCTGAATGTGGAACCAGATCTCGAGATCTGGTTCCACATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-489s1c1
Sequence:CCGGGCCTGTCTGAGTGTTAATGATCTCGAGATCATTAACACTCAGACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-597s1c1
Sequence:CCGGGAGACAGACTTATTACTAGATCTCGAGATCTAGTAATAAGTCTGTCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012094
VALIDATED
PRDX5 MISSION shRNA shRNA Plasmid DNA
peroxiredoxin 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-624s1c1
Sequence:CCGGCTGGTGTCCATCTTTGGGAATCTCGAGATTCCCAAAGATGGACACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-793s1c1
Sequence:CCGGCCTCCCTATCTCACCTGCCCACTCGAGTGGGCAGGTGAGATAGGGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-693s1c1
Sequence:CCGGGCCCTGAATGTGGAACCAGATCTCGAGATCTGGTTCCACATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-489s1c1
Sequence:CCGGGCCTGTCTGAGTGTTAATGATCTCGAGATCATTAACACTCAGACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000074195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-597s1c1
Sequence:CCGGGAGACAGACTTATTACTAGATCTCGAGATCTAGTAATAAGTCTGTCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012094
VALIDATED
PRDX5 MISSION shRNA Lentiviral Transduction Particles
peroxiredoxin 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-624s1c1
Sequence:CCGGCTGGTGTCCATCTTTGGGAATCTCGAGATTCCCAAAGATGGACACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074193    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-793s1c1
Sequence:CCGGCCTCCCTATCTCACCTGCCCACTCGAGTGGGCAGGTGAGATAGGGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-693s1c1
Sequence:CCGGGCCCTGAATGTGGAACCAGATCTCGAGATCTGGTTCCACATTCAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-489s1c1
Sequence:CCGGGCCTGTCTGAGTGTTAATGATCTCGAGATCATTAACACTCAGACAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000074195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_012094.3-597s1c1
Sequence:CCGGGAGACAGACTTATTACTAGATCTCGAGATCTAGTAATAAGTCTGTCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)