EMAIL THIS PAGE TO A FRIEND

PRELID1

PRELI domain containing 1

43 Gene Product Result for
Synonyms: PRELI PX19 SBBI12
UniProtKB ID: Q9Y255, B2R5F7, Q549N2, Q9UI13, Q9UJS9
Gene ID:
Human(27166) Summary: This gene encodes a member of the late embryogenesis abundant motif-containing protein family. The encoded protein is localized to mitochondria and may function as a cytoprotectant by regulating cell death and differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. Several related pseudogenes have been identified. [provided by RefSeq, Nov 2012]
Mouse(66494) PRELI domain containing 1
Rat(290995) PRELI domain containing 1
chicken(395819) PRELI domain containing 1
dog(479276) PRELI domain containing 1
domestic cat(101099935) PRELI domain containing 1
cow(523609) PRELI domain containing 1
sheep(101121932) PRELI domain containing 1
domestic guinea pig(100734550) PRELI domain containing 1
naked mole-rat(101726307) PRELI domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013237 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013237 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013237 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025596 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025596 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025596 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013237 Rosetta Predictions human pricing
NM_001009636 Rosetta Predictions rat pricing
NM_025596 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013237 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209422 predicted 507
2 SASI_Hs01_00209416 predicted 618
3 SASI_Hs01_00209417 predicted 749
4 SASI_Hs01_00209418 predicted 223
5 SASI_Hs02_00344431 predicted 556
6 SASI_Hs01_00209419 predicted 421
7 SASI_Hs02_00344432 predicted 545
8 SASI_Hs01_00209423 predicted 605
9 SASI_Hs01_00209424 predicted 382
10 SASI_Hs01_00209425 predicted 569
11 SASI_Hs01_00209420 predicted 238
12 SASI_Hs01_00209421 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009636 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199645 predicted 224
2 SASI_Rn02_00199646 predicted 237
3 SASI_Rn01_00084789 predicted 786
4 SASI_Rn02_00199647 predicted 680
5 SASI_Rn02_00199648 predicted 540
6 SASI_Rn02_00199649 predicted 211
7 SASI_Rn02_00199650 predicted 314
8 SASI_Rn01_00084790 predicted 532
9 SASI_Rn02_00199651 predicted 813
10 SASI_Rn02_00199652 predicted 751
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025596 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063832 predicted 725
2 SASI_Mm01_00063833 predicted 452
3 SASI_Mm01_00063834 predicted 497
4 SASI_Mm01_00063835 predicted 709
5 SASI_Mm01_00063836 predicted 595
6 SASI_Mm01_00063837 predicted 306
7 SASI_Mm01_00063838 predicted 489
8 SASI_Mm01_00063839 predicted 402
9 SASI_Mm02_00328600 predicted 656
10 SASI_Mm02_00328601 predicted 353
11 SASI_Mm01_00063840 predicted 749
12 SASI_Mm01_00063841 predicted 603
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013237
PRELID1 MISSION shRNA Bacterial Glycerol Stock
PRELI domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000352956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-576s21c1
Sequence:CCGGGCTGTCCAGGAATTTGGTCTTCTCGAGAAGACCAAATTCCTGGACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013237.2-954s21c1
Sequence:CCGGGCAGTACACCAAGCACATGATCTCGAGATCATGTGCTTGGTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-431s21c1
Sequence:CCGGGACTACCTTCACCTGGAACATCTCGAGATGTTCCAGGTGAAGGTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-576s1c1
Sequence:CCGGGCTGTCCAGGAATTTGGTCTTCTCGAGAAGACCAAATTCCTGGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013237.2-954s1c1
Sequence:CCGGGCAGTACACCAAGCACATGATCTCGAGATCATGTGCTTGGTGTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-542s1c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-431s1c1
Sequence:CCGGGACTACCTTCACCTGGAACATCTCGAGATGTTCCAGGTGAAGGTAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000127932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013237.2-987s1c1
Sequence:CCGGCAGGTCTGCTTATTCTCCCATCTCGAGATGGGAGAATAAGCAGACCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000130747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-791s1c1
Sequence:CCGGGCAGCAGCAACAGTTTGTGTACTCGAGTACACAAACTGTTGCTGCTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000343731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-791s21c1
Sequence:CCGGGCAGCAGCAACAGTTTGTGTACTCGAGTACACAAACTGTTGCTGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013237
PRELID1 MISSION shRNA shRNA Plasmid DNA
PRELI domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000352956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-576s21c1
Sequence:CCGGGCTGTCCAGGAATTTGGTCTTCTCGAGAAGACCAAATTCCTGGACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013237.2-954s21c1
Sequence:CCGGGCAGTACACCAAGCACATGATCTCGAGATCATGTGCTTGGTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-431s21c1
Sequence:CCGGGACTACCTTCACCTGGAACATCTCGAGATGTTCCAGGTGAAGGTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-576s1c1
Sequence:CCGGGCTGTCCAGGAATTTGGTCTTCTCGAGAAGACCAAATTCCTGGACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013237.2-954s1c1
Sequence:CCGGGCAGTACACCAAGCACATGATCTCGAGATCATGTGCTTGGTGTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-542s1c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-431s1c1
Sequence:CCGGGACTACCTTCACCTGGAACATCTCGAGATGTTCCAGGTGAAGGTAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013237.2-987s1c1
Sequence:CCGGCAGGTCTGCTTATTCTCCCATCTCGAGATGGGAGAATAAGCAGACCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-791s1c1
Sequence:CCGGGCAGCAGCAACAGTTTGTGTACTCGAGTACACAAACTGTTGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-791s21c1
Sequence:CCGGGCAGCAGCAACAGTTTGTGTACTCGAGTACACAAACTGTTGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013237
PRELID1 MISSION shRNA Lentiviral Transduction Particles
PRELI domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000352956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-576s21c1
Sequence:CCGGGCTGTCCAGGAATTTGGTCTTCTCGAGAAGACCAAATTCCTGGACAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013237.2-954s21c1
Sequence:CCGGGCAGTACACCAAGCACATGATCTCGAGATCATGTGCTTGGTGTACTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-431s21c1
Sequence:CCGGGACTACCTTCACCTGGAACATCTCGAGATGTTCCAGGTGAAGGTAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-576s1c1
Sequence:CCGGGCTGTCCAGGAATTTGGTCTTCTCGAGAAGACCAAATTCCTGGACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130716    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013237.2-954s1c1
Sequence:CCGGGCAGTACACCAAGCACATGATCTCGAGATCATGTGCTTGGTGTACTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-542s1c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-431s1c1
Sequence:CCGGGACTACCTTCACCTGGAACATCTCGAGATGTTCCAGGTGAAGGTAGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000127932    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013237.2-987s1c1
Sequence:CCGGCAGGTCTGCTTATTCTCCCATCTCGAGATGGGAGAATAAGCAGACCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000130747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013237.2-791s1c1
Sequence:CCGGGCAGCAGCAACAGTTTGTGTACTCGAGTACACAAACTGTTGCTGCTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000343731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013237.2-791s21c1
Sequence:CCGGGCAGCAGCAACAGTTTGTGTACTCGAGTACACAAACTGTTGCTGCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025596
VALIDATED
PRELID1 MISSION shRNA Bacterial Glycerol Stock
PRELI domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-220s21c1
Sequence:CCGGCCCTATAGCAAACATGTCTTACTCGAGTAAGACATGTTTGCTATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-810s21c1
Sequence:CCGGCCAGTGTACGTGATTATTAAACTCGAGTTTAATAATCACGTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-666s21c1
Sequence:CCGGCCTTGTTGAGACAGCCAAAGACTCGAGTCTTTGGCTGTCTCAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-525s21c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-525s1c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-666s1c1
Sequence:CCGGCCTTGTTGAGACAGCCAAAGACTCGAGTCTTTGGCTGTCTCAACAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-232s1c1
Sequence:CCGGCATGTCTTAACCGAAGACATACTCGAGTATGTCTTCGGTTAAGACATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-810s1c1
Sequence:CCGGCCAGTGTACGTGATTATTAAACTCGAGTTTAATAATCACGTACACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000120258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-220s1c1
Sequence:CCGGCCCTATAGCAAACATGTCTTACTCGAGTAAGACATGTTTGCTATAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025596
VALIDATED
PRELID1 MISSION shRNA shRNA Plasmid DNA
PRELI domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-220s21c1
Sequence:CCGGCCCTATAGCAAACATGTCTTACTCGAGTAAGACATGTTTGCTATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-810s21c1
Sequence:CCGGCCAGTGTACGTGATTATTAAACTCGAGTTTAATAATCACGTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-666s21c1
Sequence:CCGGCCTTGTTGAGACAGCCAAAGACTCGAGTCTTTGGCTGTCTCAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-525s21c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-525s1c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-666s1c1
Sequence:CCGGCCTTGTTGAGACAGCCAAAGACTCGAGTCTTTGGCTGTCTCAACAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-232s1c1
Sequence:CCGGCATGTCTTAACCGAAGACATACTCGAGTATGTCTTCGGTTAAGACATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-810s1c1
Sequence:CCGGCCAGTGTACGTGATTATTAAACTCGAGTTTAATAATCACGTACACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-220s1c1
Sequence:CCGGCCCTATAGCAAACATGTCTTACTCGAGTAAGACATGTTTGCTATAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025596
VALIDATED
PRELID1 MISSION shRNA Lentiviral Transduction Particles
PRELI domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345878    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-220s21c1
Sequence:CCGGCCCTATAGCAAACATGTCTTACTCGAGTAAGACATGTTTGCTATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345802    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-810s21c1
Sequence:CCGGCCAGTGTACGTGATTATTAAACTCGAGTTTAATAATCACGTACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345801    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-666s21c1
Sequence:CCGGCCTTGTTGAGACAGCCAAAGACTCGAGTCTTTGGCTGTCTCAACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345800    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025596.5-525s21c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-525s1c1
Sequence:CCGGCTGGGTCTCCTCTAGCTTATTCTCGAGAATAAGCTAGAGGAGACCCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-666s1c1
Sequence:CCGGCCTTGTTGAGACAGCCAAAGACTCGAGTCTTTGGCTGTCTCAACAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120259    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-232s1c1
Sequence:CCGGCATGTCTTAACCGAAGACATACTCGAGTATGTCTTCGGTTAAGACATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120257    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-810s1c1
Sequence:CCGGCCAGTGTACGTGATTATTAAACTCGAGTTTAATAATCACGTACACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000120258    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025596.5-220s1c1
Sequence:CCGGCCCTATAGCAAACATGTCTTACTCGAGTAAGACATGTTTGCTATAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)