EMAIL THIS PAGE TO A FRIEND

PRELP

proline/arginine-rich end leucine-rich repeat protein

65 Gene Product Result for
Synonyms: MST161 MSTP161 SLRR2A
UniProtKB ID: P51888, Q6FG38
Gene ID:
Human(5549) Summary: The protein encoded by this gene is a leucine-rich repeat protein present in connective tissue extracellular matrix. This protein functions as a molecule anchoring basement membranes to the underlying connective tissue. This protein has been shown to bind type I collagen to basement membranes and type II collagen to cartilage. It also binds the basement membrane heparan sulfate proteoglycan perlecan. This protein is suggested to be involved in the pathogenesis of Hutchinson-Gilford progeria (HGP), which is reported to lack the binding of collagen in basement membranes and cartilage. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(116847) proline arginine-rich end leucine-rich repeat
Rat(84400) proline/arginine-rich end leucine-rich repeat protein
cow(282000) proline/arginine-rich end leucine-rich repeat protein
sheep(101111470) proline/arginine-rich end leucine-rich repeat protein
domestic guinea pig(100726579) proline/arginine-rich end leucine-rich repeat protein
naked mole-rat(101701329) proline/arginine-rich end leucine-rich repeat protein
Zebrafish(100144408) proline/arginine-rich end leucine-rich repeat protein
domestic cat(101101284) proline/arginine-rich end leucine-rich repeat protein
chicken(419933) proline/arginine-rich end leucine-rich repeat protein
dog(488561) proline/arginine-rich end leucine-rich repeat protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1647 Human PRELP ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054077 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054077 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054077 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002725 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002725 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002725 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002725 Rosetta Predictions human pricing
NM_201348 Rosetta Predictions human pricing
NM_053385 Rosetta Predictions rat pricing
NM_054077 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042732 predicted 576
2 SASI_Hs01_00042733 predicted 1725
3 SASI_Hs01_00042734 predicted 586
4 SASI_Hs01_00042735 predicted 1005
5 SASI_Hs01_00042736 predicted 1609
6 SASI_Hs01_00042737 predicted 824
7 SASI_Hs01_00042738 predicted 1522
8 SASI_Hs01_00042739 predicted 1050
9 SASI_Hs01_00042741 predicted 1814
10 SASI_Hs02_00334324 predicted 1430
11 SASI_Hs01_00042740 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201348 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00137481 predicted 574
2 SASI_Hs01_00137482 predicted 1715
3 SASI_Hs01_00137483 predicted 570
4 SASI_Hs01_00137484 predicted 986
5 SASI_Hs01_00137485 predicted 1602
6 SASI_Hs01_00137486 predicted 819
7 SASI_Hs01_00137487 predicted 1512
8 SASI_Hs01_00137488 predicted 1048
9 SASI_Hs01_00137490 predicted 1797
10 SASI_Hs02_00372928 predicted 1423
11 SASI_Hs01_00137489 predicted 977
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050923 predicted 949
2 SASI_Rn01_00050924 predicted 1006
3 SASI_Rn01_00050925 predicted 529
4 SASI_Rn01_00050926 predicted 832
5 SASI_Rn02_00265882 predicted 465
6 SASI_Rn01_00050927 predicted 640
7 SASI_Rn01_00050928 predicted 600
8 SASI_Rn01_00050929 predicted 654
9 SASI_Rn01_00050930 predicted 1005
10 SASI_Rn01_00050931 predicted 620
11 SASI_Rn01_00050932 predicted 304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054077 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090061 predicted 221
2 SASI_Mm02_00338001 predicted 514
3 SASI_Mm02_00338002 predicted 580
4 SASI_Mm01_00090063 predicted 1047
5 SASI_Mm01_00090064 predicted 1654
6 SASI_Mm01_00090065 predicted 1015
7 SASI_Mm01_00090066 predicted 1517
8 SASI_Mm01_00090067 predicted 1393
9 SASI_Mm01_00090068 predicted 425
10 SASI_Mm01_00090069 predicted 769
11 SASI_Mm01_00090062 predicted 1719
12 SASI_Mm01_00090070 predicted 692
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054077
VALIDATED
PRELP MISSION shRNA Bacterial Glycerol Stock
proline/arginine-rich end leucine-rich repeat protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000318135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-868s21c1
Sequence:CCGGCTACCTGGATAGCAACAAGATCTCGAGATCTTGTTGCTATCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054077.3-2113s21c1
Sequence:CCGGCCACTTCATCTGCTCTCTATTCTCGAGAATAGAGAGCAGATGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-1021s21c1
Sequence:CCGGGTCTCACAACAAGATCAGCAACTCGAGTTGCTGATCTTGTTGTGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-901s21c1
Sequence:CCGGCAACGGGTACTTCAAGGACTTCTCGAGAAGTCCTTGAAGTACCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054077.2-435s1c1
Sequence:CCGGCCGAATCCATTACCTTTACTTCTCGAGAAGTAAAGGTAATGGATTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054077.2-2115s1c1
Sequence:CCGGCCACTTCATCTGCTCTCTATTCTCGAGAATAGAGAGCAGATGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-903s1c1
Sequence:CCGGCAACGGGTACTTCAAGGACTTCTCGAGAAGTCCTTGAAGTACCCGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-870s1c1
Sequence:CCGGCTACCTGGATAGCAACAAGATCTCGAGATCTTGTTGCTATCCAGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-1023s1c1
Sequence:CCGGGTCTCACAACAAGATCAGCAACTCGAGTTGCTGATCTTGTTGTGAGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054077
VALIDATED
PRELP MISSION shRNA shRNA Plasmid DNA
proline/arginine-rich end leucine-rich repeat protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000318135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-868s21c1
Sequence:CCGGCTACCTGGATAGCAACAAGATCTCGAGATCTTGTTGCTATCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054077.3-2113s21c1
Sequence:CCGGCCACTTCATCTGCTCTCTATTCTCGAGAATAGAGAGCAGATGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-1021s21c1
Sequence:CCGGGTCTCACAACAAGATCAGCAACTCGAGTTGCTGATCTTGTTGTGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000318064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-901s21c1
Sequence:CCGGCAACGGGTACTTCAAGGACTTCTCGAGAAGTCCTTGAAGTACCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054077.2-435s1c1
Sequence:CCGGCCGAATCCATTACCTTTACTTCTCGAGAAGTAAAGGTAATGGATTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054077.2-2115s1c1
Sequence:CCGGCCACTTCATCTGCTCTCTATTCTCGAGAATAGAGAGCAGATGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-903s1c1
Sequence:CCGGCAACGGGTACTTCAAGGACTTCTCGAGAAGTCCTTGAAGTACCCGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-870s1c1
Sequence:CCGGCTACCTGGATAGCAACAAGATCTCGAGATCTTGTTGCTATCCAGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000094462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-1023s1c1
Sequence:CCGGGTCTCACAACAAGATCAGCAACTCGAGTTGCTGATCTTGTTGTGAGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054077
VALIDATED
PRELP MISSION shRNA Lentiviral Transduction Particles
proline/arginine-rich end leucine-rich repeat protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000318135    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-868s21c1
Sequence:CCGGCTACCTGGATAGCAACAAGATCTCGAGATCTTGTTGCTATCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054077.3-2113s21c1
Sequence:CCGGCCACTTCATCTGCTCTCTATTCTCGAGAATAGAGAGCAGATGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-1021s21c1
Sequence:CCGGGTCTCACAACAAGATCAGCAACTCGAGTTGCTGATCTTGTTGTGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054077.3-901s21c1
Sequence:CCGGCAACGGGTACTTCAAGGACTTCTCGAGAAGTCCTTGAAGTACCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094460    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054077.2-435s1c1
Sequence:CCGGCCGAATCCATTACCTTTACTTCTCGAGAAGTAAAGGTAATGGATTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094459    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_054077.2-2115s1c1
Sequence:CCGGCCACTTCATCTGCTCTCTATTCTCGAGAATAGAGAGCAGATGAAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-903s1c1
Sequence:CCGGCAACGGGTACTTCAAGGACTTCTCGAGAAGTCCTTGAAGTACCCGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-870s1c1
Sequence:CCGGCTACCTGGATAGCAACAAGATCTCGAGATCTTGTTGCTATCCAGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000094462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054077.2-1023s1c1
Sequence:CCGGGTCTCACAACAAGATCAGCAACTCGAGTTGCTGATCTTGTTGTGAGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002725
PRELP MISSION shRNA Bacterial Glycerol Stock
proline/arginine-rich end leucine-rich repeat protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1143s1c1
Sequence:CCGGCACCTGTACCTCAACAACAATCTCGAGATTGTTGTTGAGGTACAGGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-4505s1c1
Sequence:CCGGGCCTCTTAATTGCTCTAACAACTCGAGTTGTTAGAGCAATTAAGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-3868s1c1
Sequence:CCGGGCTGGTTTCTTTCAAGTTTAACTCGAGTTAAACTTGAAAGAAACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-950s1c1
Sequence:CCGGCAGTAACAAGATTGAGACCATCTCGAGATGGTCTCAATCTTGTTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-4100s1c1
Sequence:CCGGCGGTGTGAACAGGTCAAGAATCTCGAGATTCTTGACCTGTTCACACCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-584s1c1
Sequence:CCGGGCGATGGATTAACCTGGACAACTCGAGTTGTCCAGGTTAATCCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1010s1c1
Sequence:CCGGCATTCGGCTTAACTACAACAACTCGAGTTGTTGTAGTTAAGCCGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1268s1c1
Sequence:CCGGGCTGGATGGAAACTACTTGAACTCGAGTTCAAGTAGTTTCCATCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002725
PRELP MISSION shRNA shRNA Plasmid DNA
proline/arginine-rich end leucine-rich repeat protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1143s1c1
Sequence:CCGGCACCTGTACCTCAACAACAATCTCGAGATTGTTGTTGAGGTACAGGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-4505s1c1
Sequence:CCGGGCCTCTTAATTGCTCTAACAACTCGAGTTGTTAGAGCAATTAAGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-3868s1c1
Sequence:CCGGGCTGGTTTCTTTCAAGTTTAACTCGAGTTAAACTTGAAAGAAACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000159965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-950s1c1
Sequence:CCGGCAGTAACAAGATTGAGACCATCTCGAGATGGTCTCAATCTTGTTACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000164036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-4100s1c1
Sequence:CCGGCGGTGTGAACAGGTCAAGAATCTCGAGATTCTTGACCTGTTCACACCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000163685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-584s1c1
Sequence:CCGGGCGATGGATTAACCTGGACAACTCGAGTTGTCCAGGTTAATCCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1010s1c1
Sequence:CCGGCATTCGGCTTAACTACAACAACTCGAGTTGTTGTAGTTAAGCCGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000161205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1268s1c1
Sequence:CCGGGCTGGATGGAAACTACTTGAACTCGAGTTCAAGTAGTTTCCATCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002725
PRELP MISSION shRNA Lentiviral Transduction Particles
proline/arginine-rich end leucine-rich repeat protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1143s1c1
Sequence:CCGGCACCTGTACCTCAACAACAATCTCGAGATTGTTGTTGAGGTACAGGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159287    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-4505s1c1
Sequence:CCGGGCCTCTTAATTGCTCTAACAACTCGAGTTGTTAGAGCAATTAAGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158950    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-3868s1c1
Sequence:CCGGGCTGGTTTCTTTCAAGTTTAACTCGAGTTAAACTTGAAAGAAACCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000159965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-950s1c1
Sequence:CCGGCAGTAACAAGATTGAGACCATCTCGAGATGGTCTCAATCTTGTTACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000164036    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002725.3-4100s1c1
Sequence:CCGGCGGTGTGAACAGGTCAAGAATCTCGAGATTCTTGACCTGTTCACACCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000163685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-584s1c1
Sequence:CCGGGCGATGGATTAACCTGGACAACTCGAGTTGTCCAGGTTAATCCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1010s1c1
Sequence:CCGGCATTCGGCTTAACTACAACAACTCGAGTTGTTGTAGTTAAGCCGAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000161205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002725.3-1268s1c1
Sequence:CCGGGCTGGATGGAAACTACTTGAACTCGAGTTCAAGTAGTTTCCATCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)