EMAIL THIS PAGE TO A FRIEND

PREP

prolyl endopeptidase

84 Gene Product Result for
Synonyms: PE PEP
UniProtKB ID: P48147, Q8N6D4
Gene ID:
Human(5550) Summary: The protein encoded by this gene is a cytosolic prolyl endopeptidase that cleaves peptide bonds on the C-terminal side of prolyl residues within peptides that are up to approximately 30 amino acids long. Prolyl endopeptidases have been reported to be involved in the maturation and degradation of peptide hormones and neuropeptides. [provided by RefSeq, Jul 2008]
Mouse(19072) prolyl endopeptidase
Rat(83471) prolyl endopeptidase
Zebrafish(553791) prolyl endopeptidase
Horse(100071926) prolyl endopeptidase
dog(481945) prolyl endopeptidase
chicken(421785) prolyl endopeptidase
domestic cat(101095900) prolyl endopeptidase
naked mole-rat(101721033) prolyl endopeptidase
domestic guinea pig(100734888) prolyl endopeptidase
cow(286818) prolyl endopeptidase
sheep(101110768) prolyl endopeptidase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1100423 Anti-PREP (186-200) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2501783 Anti-PREP antibody produced in goat affinity isolated antibody, buffered aqueous solution human, bovine, canine, rat, pig, mouse
ELISA, immunohistochemistry pricing
SAB2108324 Anti-PREP antibody produced in rabbit affinity isolated antibody horse, guinea pig, rabbit, mouse, dog, human, rat
western blot pricing
SAB2104775 Anti-PREP antibody produced in rabbit affinity isolated antibody dog, guinea pig, rat, rabbit, horse, human, bovine, mouse
western blot pricing
HPA031388 Anti-PREP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031389 Anti-PREP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA031390 Anti-PREP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2104515 Anti-PREP, (N-terminal) antibody produced in rabbit affinity isolated antibody, lyophilized powder pig, human, horse, rat, bovine, chicken, mouse, zebrafish, rabbit
western blot pricing
SAB1401302 Monoclonal Anti-PREP antibody produced in mouse clone 2D7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002726 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002726 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002726 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002726 Rosetta Predictions human pricing
NM_031324 Rosetta Predictions rat pricing
NM_011156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105882 predicted 585
2 SASI_Hs01_00105885 predicted 1482
3 SASI_Hs02_00334325 predicted 1361
4 SASI_Hs01_00105886 predicted 766
5 SASI_Hs01_00105888 predicted 1839
6 SASI_Hs01_00105890 predicted 1867
7 SASI_Hs02_00334326 predicted 1976
8 SASI_Hs01_00105891 predicted 1169
9 SASI_Hs02_00334327 predicted 417
10 SASI_Hs02_00334328 predicted 1294
11 SASI_Hs01_00105883 predicted 495
12 SASI_Hs01_00105884 predicted 707
13 SASI_Hs01_00105887 predicted 1548
14 SASI_Hs01_00105889 predicted 1657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031324 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091747 predicted 504
2 SASI_Rn01_00091748 predicted 1781
3 SASI_Rn01_00091749 predicted 1031
4 SASI_Rn01_00091750 predicted 635
5 SASI_Rn01_00091751 predicted 840
6 SASI_Rn01_00091752 predicted 2208
7 SASI_Rn01_00091753 predicted 295
8 SASI_Rn01_00091754 predicted 1135
9 SASI_Rn01_00091755 predicted 1412
10 SASI_Rn01_00091756 predicted 864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00150180 predicted 1787
2 SASI_Mm01_00150181 predicted 1041
3 SASI_Mm01_00150182 predicted 2193
4 SASI_Mm01_00150183 predicted 398
5 SASI_Mm01_00150184 predicted 1317
6 SASI_Mm01_00150185 predicted 1710
7 SASI_Mm01_00150186 predicted 1455
8 SASI_Mm01_00150187 predicted 305
9 SASI_Mm02_00320015 predicted 2180
10 SASI_Mm01_00150189 predicted 970
11 SASI_Mm01_00150188 predicted 1493
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002726
VALIDATED
PREP MISSION shRNA Bacterial Glycerol Stock
prolyl endopeptidase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000050198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-936s1c1
Sequence:CCGGCGCTATGTCTTGTTATCAATACTCGAGTATTGATAACAAGACATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-549s1c1
Sequence:CCGGCCCAACATACTGTCTGACGATCTCGAGATCGTCAGACAGTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-1602s1c1
Sequence:CCGGCCAGCTTTCTTATATGGCTATCTCGAGATAGCCATATAAGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002726.3-1979s1c1
Sequence:CCGGCCATGCTTGGACCACTGATTACTCGAGTAATCAGTGGTCCAAGCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-1905s1c1
Sequence:CCGGCCTGACCTCTTTGGTTGTGTTCTCGAGAACACAACCAAAGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-936s21c1
Sequence:CCGGCGCTATGTCTTGTTATCAATACTCGAGTATTGATAACAAGACATAGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-1602s21c1
Sequence:CCGGCCAGCTTTCTTATATGGCTATCTCGAGATAGCCATATAAGAAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-1905s21c1
Sequence:CCGGCCTGACCTCTTTGGTTGTGTTCTCGAGAACACAACCAAAGAGGTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-549s21c1
Sequence:CCGGCCCAACATACTGTCTGACGATCTCGAGATCGTCAGACAGTATGTTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002726
VALIDATED
PREP MISSION shRNA shRNA Plasmid DNA
prolyl endopeptidase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000050198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-936s1c1
Sequence:CCGGCGCTATGTCTTGTTATCAATACTCGAGTATTGATAACAAGACATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-549s1c1
Sequence:CCGGCCCAACATACTGTCTGACGATCTCGAGATCGTCAGACAGTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-1602s1c1
Sequence:CCGGCCAGCTTTCTTATATGGCTATCTCGAGATAGCCATATAAGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002726.3-1979s1c1
Sequence:CCGGCCATGCTTGGACCACTGATTACTCGAGTAATCAGTGGTCCAAGCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000050200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-1905s1c1
Sequence:CCGGCCTGACCTCTTTGGTTGTGTTCTCGAGAACACAACCAAAGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-936s21c1
Sequence:CCGGCGCTATGTCTTGTTATCAATACTCGAGTATTGATAACAAGACATAGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-1602s21c1
Sequence:CCGGCCAGCTTTCTTATATGGCTATCTCGAGATAGCCATATAAGAAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-1905s21c1
Sequence:CCGGCCTGACCTCTTTGGTTGTGTTCTCGAGAACACAACCAAAGAGGTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000288956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-549s21c1
Sequence:CCGGCCCAACATACTGTCTGACGATCTCGAGATCGTCAGACAGTATGTTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002726
VALIDATED
PREP MISSION shRNA Lentiviral Transduction Particles
prolyl endopeptidase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000050198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-936s1c1
Sequence:CCGGCGCTATGTCTTGTTATCAATACTCGAGTATTGATAACAAGACATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-549s1c1
Sequence:CCGGCCCAACATACTGTCTGACGATCTCGAGATCGTCAGACAGTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-1602s1c1
Sequence:CCGGCCAGCTTTCTTATATGGCTATCTCGAGATAGCCATATAAGAAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002726.3-1979s1c1
Sequence:CCGGCCATGCTTGGACCACTGATTACTCGAGTAATCAGTGGTCCAAGCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000050200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_002726.3-1905s1c1
Sequence:CCGGCCTGACCTCTTTGGTTGTGTTCTCGAGAACACAACCAAAGAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-936s21c1
Sequence:CCGGCGCTATGTCTTGTTATCAATACTCGAGTATTGATAACAAGACATAGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288890    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-1602s21c1
Sequence:CCGGCCAGCTTTCTTATATGGCTATCTCGAGATAGCCATATAAGAAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-1905s21c1
Sequence:CCGGCCTGACCTCTTTGGTTGTGTTCTCGAGAACACAACCAAAGAGGTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000288956    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002726.3-549s21c1
Sequence:CCGGCCCAACATACTGTCTGACGATCTCGAGATCGTCAGACAGTATGTTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011156
PREP MISSION shRNA Bacterial Glycerol Stock
prolyl endopeptidase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1457s1c1
Sequence:CCGGGCACCAAGATTCCCATGTTTACTCGAGTAAACATGGGAATCTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1948s1c1
Sequence:CCGGCTTCTCAAATACTCGCCACTACTCGAGTAGTGGCGAGTATTTGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-939s1c1
Sequence:CCGGCGGAATCCTGAAGTGGGTAAACTCGAGTTTACCCACTTCAGGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-165s1c1
Sequence:CCGGGCAGGAGTATCATGGACATAACTCGAGTTATGTCCATGATACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1028s1c1
Sequence:CCGGCGAACCGCAATTCTCCCAATTCTCGAGAATTGGGAGAATTGCGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1457s21c1
Sequence:CCGGGCACCAAGATTCCCATGTTTACTCGAGTAAACATGGGAATCTTGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-165s21c1
Sequence:CCGGGCAGGAGTATCATGGACATAACTCGAGTTATGTCCATGATACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1028s21c1
Sequence:CCGGCGAACCGCAATTCTCCCAATTCTCGAGAATTGGGAGAATTGCGGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-939s21c1
Sequence:CCGGCGGAATCCTGAAGTGGGTAAACTCGAGTTTACCCACTTCAGGATTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1948s21c1
Sequence:CCGGCTTCTCAAATACTCGCCACTACTCGAGTAGTGGCGAGTATTTGAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011156
PREP MISSION shRNA shRNA Plasmid DNA
prolyl endopeptidase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1457s1c1
Sequence:CCGGGCACCAAGATTCCCATGTTTACTCGAGTAAACATGGGAATCTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1948s1c1
Sequence:CCGGCTTCTCAAATACTCGCCACTACTCGAGTAGTGGCGAGTATTTGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-939s1c1
Sequence:CCGGCGGAATCCTGAAGTGGGTAAACTCGAGTTTACCCACTTCAGGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-165s1c1
Sequence:CCGGGCAGGAGTATCATGGACATAACTCGAGTTATGTCCATGATACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1028s1c1
Sequence:CCGGCGAACCGCAATTCTCCCAATTCTCGAGAATTGGGAGAATTGCGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1457s21c1
Sequence:CCGGGCACCAAGATTCCCATGTTTACTCGAGTAAACATGGGAATCTTGGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-165s21c1
Sequence:CCGGGCAGGAGTATCATGGACATAACTCGAGTTATGTCCATGATACTCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000349147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1028s21c1
Sequence:CCGGCGAACCGCAATTCTCCCAATTCTCGAGAATTGGGAGAATTGCGGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-939s21c1
Sequence:CCGGCGGAATCCTGAAGTGGGTAAACTCGAGTTTACCCACTTCAGGATTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000316066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1948s21c1
Sequence:CCGGCTTCTCAAATACTCGCCACTACTCGAGTAGTGGCGAGTATTTGAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011156
PREP MISSION shRNA Lentiviral Transduction Particles
prolyl endopeptidase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033139    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1457s1c1
Sequence:CCGGGCACCAAGATTCCCATGTTTACTCGAGTAAACATGGGAATCTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033142    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1948s1c1
Sequence:CCGGCTTCTCAAATACTCGCCACTACTCGAGTAGTGGCGAGTATTTGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-939s1c1
Sequence:CCGGCGGAATCCTGAAGTGGGTAAACTCGAGTTTACCCACTTCAGGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-165s1c1
Sequence:CCGGGCAGGAGTATCATGGACATAACTCGAGTTATGTCCATGATACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033140    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011156.2-1028s1c1
Sequence:CCGGCGAACCGCAATTCTCCCAATTCTCGAGAATTGGGAGAATTGCGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1457s21c1
Sequence:CCGGGCACCAAGATTCCCATGTTTACTCGAGTAAACATGGGAATCTTGGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-165s21c1
Sequence:CCGGGCAGGAGTATCATGGACATAACTCGAGTTATGTCCATGATACTCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1028s21c1
Sequence:CCGGCGAACCGCAATTCTCCCAATTCTCGAGAATTGGGAGAATTGCGGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-939s21c1
Sequence:CCGGCGGAATCCTGAAGTGGGTAAACTCGAGTTTACCCACTTCAGGATTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000316066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011156.2-1948s21c1
Sequence:CCGGCTTCTCAAATACTCGCCACTACTCGAGTAGTGGCGAGTATTTGAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)