EMAIL THIS PAGE TO A FRIEND

PREX2

phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2

94 Gene Product Result for
Synonyms: 6230420N16Rik DEP.2 DEPDC2 P-REX2
Gene ID:
Mouse(109294) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Rat(312912) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
cow(520704) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
sheep(101103244) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
domestic guinea pig(100713893) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
naked mole-rat(101706094) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Domestic Rabbit(100346695) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
chicken(420172) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
domestic cat(101096379) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Horse(100063148) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
dog(486984) phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025170 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025170 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025170 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_484831 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_484831 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_484831 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024870 Rosetta Predictions human pricing
NM_025170 Rosetta Predictions human pricing
NM_001107899 Rosetta Predictions rat pricing
NM_001033636 Rosetta Predictions mouse pricing
NM_029525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024870 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215577 predicted 1235
2 SASI_Hs01_00215578 predicted 1260
3 SASI_Hs01_00215580 predicted 668
4 SASI_Hs01_00215581 predicted 1364
5 SASI_Hs01_00215582 predicted 2207
6 SASI_Hs02_00357459 predicted 507
7 SASI_Hs02_00357460 predicted 330
8 SASI_Hs01_00215585 predicted 264
9 SASI_Hs01_00215586 predicted 1936
10 SASI_Hs02_00357461 predicted 492
11 SASI_Hs01_00215579 predicted 2287
12 SASI_Hs01_00215583 predicted 2470
13 SASI_Hs01_00215584 predicted 994
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025170 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357924 predicted 592
2 SASI_Hs01_00063058 predicted 1236
3 SASI_Hs01_00063059 predicted 1261
4 SASI_Hs01_00063061 predicted 667
5 SASI_Hs01_00063062 predicted 1368
6 SASI_Hs01_00063063 predicted 2203
7 SASI_Hs02_00357925 predicted 325
8 SASI_Hs01_00063066 predicted 271
9 SASI_Hs01_00063067 predicted 1936
10 SASI_Hs02_00357926 predicted 495
11 SASI_Hs01_00063060 predicted 2288
12 SASI_Hs01_00063064 predicted 2468
13 SASI_Hs01_00063065 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107899 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233375 predicted 2851
2 SASI_Rn02_00233376 predicted 4215
3 SASI_Rn02_00233377 predicted 2055
4 SASI_Rn02_00233378 predicted 1556
5 SASI_Rn02_00233379 predicted 1390
6 SASI_Rn02_00233380 predicted 3475
7 SASI_Rn02_00233381 predicted 774
8 SASI_Rn02_00233382 predicted 1689
9 SASI_Rn02_00233383 predicted 1333
10 SASI_Rn02_00233384 predicted 1522
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181005 predicted 768
2 SASI_Mm01_00181007 predicted 734
3 SASI_Mm01_00181008 predicted 682
4 SASI_Mm01_00181009 predicted 717
5 SASI_Mm02_00288954 predicted 733
6 SASI_Mm02_00288955 predicted 991
7 SASI_Mm01_00181011 predicted 663
8 SASI_Mm02_00288956 predicted 1076
9 SASI_Mm02_00288957 predicted 1001
10 SASI_Mm02_00288958 predicted 1031
11 SASI_Mm01_00181006 predicted 421
12 SASI_Mm01_00181010 predicted 246
13 SASI_Mm01_00181012 predicted 891
14 SASI_Mm01_00181013 predicted 749
15 SASI_Mm01_00181014 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335471 predicted 5291
2 SASI_Mm02_00335472 predicted 5246
3 SASI_Mm02_00335473 predicted 5197
4 SASI_Mm02_00335474 predicted 5233
5 SASI_Mm02_00335475 predicted 5245
6 SASI_Mm02_00335476 predicted 5507
7 SASI_Mm02_00335477 predicted 5185
8 SASI_Mm02_00335478 predicted 5590
9 SASI_Mm02_00335479 predicted 5513
10 SASI_Mm02_00335480 predicted 5551
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025170
PREX2 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1497s1c1
Sequence:CCGGCCCTGGACAGTGCATTATCAACTCGAGTTGATAATGCACTGTCCAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-594s1c1
Sequence:CCGGCGAATTTGTGTCATGGCTGTTCTCGAGAACAGCCATGACACAAATTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-2203s1c1
Sequence:CCGGCTCTTAGGAATATCCCAGGATCTCGAGATCCTGGGATATTCCTAAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-402s1c1
Sequence:CCGGGCATGAATGGTTTGAAGCTATCTCGAGATAGCTTCAAACCATTCATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-493s1c1
Sequence:CCGGGAACAGGGTGAGAAACTTTATCTCGAGATAAAGTTTCTCACCCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-946s1c1
Sequence:CCGGGAGGCAATGATATTTGGCGTTCTCGAGAACGCCAAATATCATTGCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-192s1c1
Sequence:CCGGCAGACGGTTGAAGAACAGCAACTCGAGTTGCTGTTCTTCAACCGTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1878s1c1
Sequence:CCGGGCCCAAAGGTTTCTTCAGCTTCTCGAGAAGCTGAAGAAACCTTTGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1553s1c1
Sequence:CCGGCCAGTGTCATTGCACACGTTACTCGAGTAACGTGTGCAATGACACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-2254s1c1
Sequence:CCGGCCTTCTCAAGAAATGCTCTTACTCGAGTAAGAGCATTTCTTGAGAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025170
PREX2 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1497s1c1
Sequence:CCGGCCCTGGACAGTGCATTATCAACTCGAGTTGATAATGCACTGTCCAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-594s1c1
Sequence:CCGGCGAATTTGTGTCATGGCTGTTCTCGAGAACAGCCATGACACAAATTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-2203s1c1
Sequence:CCGGCTCTTAGGAATATCCCAGGATCTCGAGATCCTGGGATATTCCTAAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-402s1c1
Sequence:CCGGGCATGAATGGTTTGAAGCTATCTCGAGATAGCTTCAAACCATTCATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-493s1c1
Sequence:CCGGGAACAGGGTGAGAAACTTTATCTCGAGATAAAGTTTCTCACCCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000153578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-946s1c1
Sequence:CCGGGAGGCAATGATATTTGGCGTTCTCGAGAACGCCAAATATCATTGCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000158258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-192s1c1
Sequence:CCGGCAGACGGTTGAAGAACAGCAACTCGAGTTGCTGTTCTTCAACCGTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000156584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1878s1c1
Sequence:CCGGGCCCAAAGGTTTCTTCAGCTTCTCGAGAAGCTGAAGAAACCTTTGGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000157338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1553s1c1
Sequence:CCGGCCAGTGTCATTGCACACGTTACTCGAGTAACGTGTGCAATGACACTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-2254s1c1
Sequence:CCGGCCTTCTCAAGAAATGCTCTTACTCGAGTAAGAGCATTTCTTGAGAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025170
PREX2 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158317    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1497s1c1
Sequence:CCGGCCCTGGACAGTGCATTATCAACTCGAGTTGATAATGCACTGTCCAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-594s1c1
Sequence:CCGGCGAATTTGTGTCATGGCTGTTCTCGAGAACAGCCATGACACAAATTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-2203s1c1
Sequence:CCGGCTCTTAGGAATATCCCAGGATCTCGAGATCCTGGGATATTCCTAAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150900    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-402s1c1
Sequence:CCGGGCATGAATGGTTTGAAGCTATCTCGAGATAGCTTCAAACCATTCATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-493s1c1
Sequence:CCGGGAACAGGGTGAGAAACTTTATCTCGAGATAAAGTTTCTCACCCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000153578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-946s1c1
Sequence:CCGGGAGGCAATGATATTTGGCGTTCTCGAGAACGCCAAATATCATTGCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000158258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-192s1c1
Sequence:CCGGCAGACGGTTGAAGAACAGCAACTCGAGTTGCTGTTCTTCAACCGTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000156584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1878s1c1
Sequence:CCGGGCCCAAAGGTTTCTTCAGCTTCTCGAGAAGCTGAAGAAACCTTTGGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000157338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-1553s1c1
Sequence:CCGGCCAGTGTCATTGCACACGTTACTCGAGTAACGTGTGCAATGACACTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025170.2-2254s1c1
Sequence:CCGGCCTTCTCAAGAAATGCTCTTACTCGAGTAAGAGCATTTCTTGAGAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_484831
PREX2 MISSION shRNA Bacterial Glycerol Stock
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000081350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-583s1c1
Sequence:CCGGCACCTCCAGTAGGAGAAGAATCTCGAGATTCTTCTCCTACTGGAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484831.1-664s1c1
Sequence:CCGGCCGAAGACAAAGAGATGCAAACTCGAGTTTGCATCTCTTTGTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-233s1c1
Sequence:CCGGCCGGCTGATCACCTCATTTATCTCGAGATAAATGAGGTGATCAGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-243s1c1
Sequence:CCGGACCTCATTTATCAGATCCAAACTCGAGTTTGGATCTGATAAATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-408s1c1
Sequence:CCGGCTAGAGCAAACCATCACTTTACTCGAGTAAAGTGATGGTTTGCTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_484831
PREX2 MISSION shRNA shRNA Plasmid DNA
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000081350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-583s1c1
Sequence:CCGGCACCTCCAGTAGGAGAAGAATCTCGAGATTCTTCTCCTACTGGAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484831.1-664s1c1
Sequence:CCGGCCGAAGACAAAGAGATGCAAACTCGAGTTTGCATCTCTTTGTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-233s1c1
Sequence:CCGGCCGGCTGATCACCTCATTTATCTCGAGATAAATGAGGTGATCAGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-243s1c1
Sequence:CCGGACCTCATTTATCAGATCCAAACTCGAGTTTGGATCTGATAAATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000081351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-408s1c1
Sequence:CCGGCTAGAGCAAACCATCACTTTACTCGAGTAAAGTGATGGTTTGCTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_484831
PREX2 MISSION shRNA Lentiviral Transduction Particles
phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000081350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-583s1c1
Sequence:CCGGCACCTCCAGTAGGAGAAGAATCTCGAGATTCTTCTCCTACTGGAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_484831.1-664s1c1
Sequence:CCGGCCGAAGACAAAGAGATGCAAACTCGAGTTTGCATCTCTTTGTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-233s1c1
Sequence:CCGGCCGGCTGATCACCTCATTTATCTCGAGATAAATGAGGTGATCAGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-243s1c1
Sequence:CCGGACCTCATTTATCAGATCCAAACTCGAGTTTGGATCTGATAAATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000081351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_484831.1-408s1c1
Sequence:CCGGCTAGAGCAAACCATCACTTTACTCGAGTAAAGTGATGGTTTGCTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)