EMAIL THIS PAGE TO A FRIEND

PRF1

perforin 1 (pore forming protein)

92 Gene Product Result for
Synonyms: FLH2 HPLH2 P1 PFN1 PFP
UniProtKB ID: P14222, B2R6X4, Q59F57, Q86WX7
Gene ID:
Human(5551) Summary: The protein encoded by this gene has structural and functional similarities to complement component 9 (C9). Like C9, this protein creates transmembrane tubules and is capable of lysing non-specifically a variety of target cells. This protein is one of the main cytolytic proteins of cytolytic granules, and it is known to be a key effector molecule for T-cell- and natural killer-cell-mediated cytolysis. Defects in this gene cause familial hemophagocytic lymphohistiocytosis type 2 (HPLH2), a rare and lethal autosomal recessive disorder of early childhood. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2008]
Mouse(18646) perforin 1 (pore forming protein)
Rat(50669) perforin 1 (pore forming protein)
Thale Cress(816495) profilin 1
Horse(100072744) perforin 1 (pore forming protein)
domestic cat(100113473) perforin 1 (pore forming protein)
dog(489030) perforin 1 (pore forming protein)
chicken(427784) perforin 1 (pore forming protein)
naked mole-rat(101717851) perforin 1 (pore forming protein)
domestic guinea pig(100730283) perforin 1 (pore forming protein)
cow(369025) perforin 1 (pore forming protein)
sheep(101110903) perforin 1 (pore forming protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011073 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011073 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011073 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005041 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005041 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005041 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083116 Rosetta Predictions human pricing
NM_005041 Rosetta Predictions human pricing
NM_017330 Rosetta Predictions rat pricing
NM_011073 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083116 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316874 predicted 1123
2 SASI_Hs02_00316875 predicted 676
3 SASI_Hs02_00316876 predicted 1069
4 SASI_Hs02_00316877 predicted 558
5 SASI_Hs02_00316878 predicted 1341
6 SASI_Hs02_00316879 predicted 970
7 SASI_Hs02_00316880 predicted 1644
8 SASI_Hs02_00316881 predicted 615
9 SASI_Hs02_00316882 predicted 932
10 SASI_Hs02_00316883 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00053995 predicted 1099
2 SASI_Hs01_00053996 predicted 651
3 SASI_Hs01_00053997 predicted 1050
4 SASI_Hs01_00053999 predicted 533
5 SASI_Hs02_00338837 predicted 1312
6 SASI_Hs02_00338838 predicted 939
7 SASI_Hs01_00054001 predicted 1615
8 SASI_Hs01_00054002 predicted 595
9 SASI_Hs01_00054004 predicted 907
10 SASI_Hs02_00338839 predicted 1562
11 SASI_Hs01_00053998 predicted 542
12 SASI_Hs01_00054000 predicted 1649
13 SASI_Hs01_00054003 predicted 207
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017330 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00099012 predicted 534
2 SASI_Rn01_00099013 predicted 1341
3 SASI_Rn01_00099014 predicted 883
4 SASI_Rn01_00099016 predicted 689
5 SASI_Rn01_00099017 predicted 688
6 SASI_Rn01_00099018 predicted 1433
7 SASI_Rn01_00099019 predicted 1200
8 SASI_Rn01_00099020 predicted 540
9 SASI_Rn01_00099021 predicted 352
10 SASI_Rn02_00261785 predicted 613
11 SASI_Rn01_00099015 predicted 919
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011073 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108012 predicted 1136
2 SASI_Mm02_00319842 predicted 1134
3 SASI_Mm01_00108013 predicted 747
4 SASI_Mm01_00108014 predicted 537
5 SASI_Mm01_00108015 predicted 1294
6 SASI_Mm01_00108016 predicted 1434
7 SASI_Mm01_00108018 predicted 416
8 SASI_Mm01_00108019 predicted 1310
9 SASI_Mm01_00108021 predicted 1355
10 SASI_Mm02_00319843 predicted 1520
11 SASI_Mm01_00108017 predicted 1360
12 SASI_Mm01_00108020 predicted 1217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011073
PRF1 MISSION shRNA Bacterial Glycerol Stock
perforin 1 (pore forming protein)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1404s1c1
Sequence:CCGGCGGTGTCGTGTGGAACAATAACTCGAGTTATTGTTCCACACGACACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011073.2-1918s1c1
Sequence:CCGGCTATGCATAGAGAGGCCACTACTCGAGTAGTGGCCTCTCTATGCATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1600s1c1
Sequence:CCGGAGGGTGAAATTCTCCTACCATCTCGAGATGGTAGGAGAATTTCACCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-504s1c1
Sequence:CCGGCCACTCCAAGGTAGCCAATTTCTCGAGAAATTGGCTACCTTGGAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1297s1c1
Sequence:CCGGGCCCATTTGGTGGTAAGCAATCTCGAGATTGCTTACCACCAAATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1135s21c1
Sequence:CCGGACAGGCTATCAGCCATTATATCTCGAGATATAATGGCTGATAGCCTGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1235s21c1
Sequence:CCGGTGTGAGTGCCAGGATTCAAAGCTCGAGCTTTGAATCCTGGCACTCACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-347s21c1
Sequence:CCGGAGCTCACACTGCCAGCGTAATCTCGAGATTACGCTGGCAGTGTGAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1351s21c1
Sequence:CCGGAGCTACTGATGCCTACCTAAACTCGAGTTTAGGTAGGCATCAGTAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1207s21c1
Sequence:CCGGGCATAAGAGTAGCCATGATTCCTCGAGGAATCATGGCTACTCTTATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011073
PRF1 MISSION shRNA shRNA Plasmid DNA
perforin 1 (pore forming protein)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1404s1c1
Sequence:CCGGCGGTGTCGTGTGGAACAATAACTCGAGTTATTGTTCCACACGACACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011073.2-1918s1c1
Sequence:CCGGCTATGCATAGAGAGGCCACTACTCGAGTAGTGGCCTCTCTATGCATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1600s1c1
Sequence:CCGGAGGGTGAAATTCTCCTACCATCTCGAGATGGTAGGAGAATTTCACCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-504s1c1
Sequence:CCGGCCACTCCAAGGTAGCCAATTTCTCGAGAAATTGGCTACCTTGGAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000077204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1297s1c1
Sequence:CCGGGCCCATTTGGTGGTAAGCAATCTCGAGATTGCTTACCACCAAATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1135s21c1
Sequence:CCGGACAGGCTATCAGCCATTATATCTCGAGATATAATGGCTGATAGCCTGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000433560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1235s21c1
Sequence:CCGGTGTGAGTGCCAGGATTCAAAGCTCGAGCTTTGAATCCTGGCACTCACATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-347s21c1
Sequence:CCGGAGCTCACACTGCCAGCGTAATCTCGAGATTACGCTGGCAGTGTGAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1351s21c1
Sequence:CCGGAGCTACTGATGCCTACCTAAACTCGAGTTTAGGTAGGCATCAGTAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1207s21c1
Sequence:CCGGGCATAAGAGTAGCCATGATTCCTCGAGGAATCATGGCTACTCTTATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011073
PRF1 MISSION shRNA Lentiviral Transduction Particles
perforin 1 (pore forming protein)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1404s1c1
Sequence:CCGGCGGTGTCGTGTGGAACAATAACTCGAGTTATTGTTCCACACGACACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077203    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011073.2-1918s1c1
Sequence:CCGGCTATGCATAGAGAGGCCACTACTCGAGTAGTGGCCTCTCTATGCATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1600s1c1
Sequence:CCGGAGGGTGAAATTCTCCTACCATCTCGAGATGGTAGGAGAATTTCACCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-504s1c1
Sequence:CCGGCCACTCCAAGGTAGCCAATTTCTCGAGAAATTGGCTACCTTGGAGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000077204    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011073.2-1297s1c1
Sequence:CCGGGCCCATTTGGTGGTAAGCAATCTCGAGATTGCTTACCACCAAATGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1135s21c1
Sequence:CCGGACAGGCTATCAGCCATTATATCTCGAGATATAATGGCTGATAGCCTGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000433560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1235s21c1
Sequence:CCGGTGTGAGTGCCAGGATTCAAAGCTCGAGCTTTGAATCCTGGCACTCACATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429202    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-347s21c1
Sequence:CCGGAGCTCACACTGCCAGCGTAATCTCGAGATTACGCTGGCAGTGTGAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426440    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1351s21c1
Sequence:CCGGAGCTACTGATGCCTACCTAAACTCGAGTTTAGGTAGGCATCAGTAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011073.3-1207s21c1
Sequence:CCGGGCATAAGAGTAGCCATGATTCCTCGAGGAATCATGGCTACTCTTATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005041
PRF1 MISSION shRNA Bacterial Glycerol Stock
perforin 1 (pore forming protein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-1427s1c1
Sequence:CCGGGCCTATGTGAAGCTCTTCTTTCTCGAGAAAGAAGAGCTTCACATAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-644s1c1
Sequence:CCGGTGCCGCTTCTACAGTTTCCATCTCGAGATGGAAACTGTAGAAGCGGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005041.3-2039s1c1
Sequence:CCGGCCAACACAATTCTTCTTCCAACTCGAGTTGGAAGAAGAATTGTGTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-754s1c1
Sequence:CCGGCCTCAGGCTTATCTCCAACTACTCGAGTAGTTGGAGATAAGCCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-1650s1c1
Sequence:CCGGACCTGAATCATGGCCACCTAACTCGAGTTAGGTGGCCATGATTCAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005041.4-2025s21c1
Sequence:CCGGATCGTTAGTGCTAGTGGATTTCTCGAGAAATCCACTAGCACTAACGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005041.4-2155s21c1
Sequence:CCGGTGGCTGGGTTTACACGCTAATCTCGAGATTAGCGTGTAAACCCAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005041.4-1485s21c1
Sequence:CCGGGAGCACCGTGTGGGACAATAACTCGAGTTATTGTCCCACACGGTGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005041
PRF1 MISSION shRNA shRNA Plasmid DNA
perforin 1 (pore forming protein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-1427s1c1
Sequence:CCGGGCCTATGTGAAGCTCTTCTTTCTCGAGAAAGAAGAGCTTCACATAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-644s1c1
Sequence:CCGGTGCCGCTTCTACAGTTTCCATCTCGAGATGGAAACTGTAGAAGCGGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005041.3-2039s1c1
Sequence:CCGGCCAACACAATTCTTCTTCCAACTCGAGTTGGAAGAAGAATTGTGTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-754s1c1
Sequence:CCGGCCTCAGGCTTATCTCCAACTACTCGAGTAGTTGGAGATAAGCCTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000007942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-1650s1c1
Sequence:CCGGACCTGAATCATGGCCACCTAACTCGAGTTAGGTGGCCATGATTCAGGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005041.4-2025s21c1
Sequence:CCGGATCGTTAGTGCTAGTGGATTTCTCGAGAAATCCACTAGCACTAACGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005041.4-2155s21c1
Sequence:CCGGTGGCTGGGTTTACACGCTAATCTCGAGATTAGCGTGTAAACCCAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005041.4-1485s21c1
Sequence:CCGGGAGCACCGTGTGGGACAATAACTCGAGTTATTGTCCCACACGGTGCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005041
PRF1 MISSION shRNA Lentiviral Transduction Particles
perforin 1 (pore forming protein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-1427s1c1
Sequence:CCGGGCCTATGTGAAGCTCTTCTTTCTCGAGAAAGAAGAGCTTCACATAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-644s1c1
Sequence:CCGGTGCCGCTTCTACAGTTTCCATCTCGAGATGGAAACTGTAGAAGCGGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005041.3-2039s1c1
Sequence:CCGGCCAACACAATTCTTCTTCCAACTCGAGTTGGAAGAAGAATTGTGTTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-754s1c1
Sequence:CCGGCCTCAGGCTTATCTCCAACTACTCGAGTAGTTGGAGATAAGCCTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000007942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005041.3-1650s1c1
Sequence:CCGGACCTGAATCATGGCCACCTAACTCGAGTTAGGTGGCCATGATTCAGGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420770    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005041.4-2025s21c1
Sequence:CCGGATCGTTAGTGCTAGTGGATTTCTCGAGAAATCCACTAGCACTAACGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429477    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005041.4-2155s21c1
Sequence:CCGGTGGCTGGGTTTACACGCTAATCTCGAGATTAGCGTGTAAACCCAGCCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005041.4-1485s21c1
Sequence:CCGGGAGCACCGTGTGGGACAATAACTCGAGTTATTGTCCCACACGGTGCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)