EMAIL THIS PAGE TO A FRIEND

PRG2

proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)

46 Gene Product Result for
Synonyms: BMPG MBP MBP1
UniProtKB ID: P13727, P81448, Q14227, Q6ICT2
Gene ID:
Human(5553) Summary: The protein encoded by this gene is the predominant constituent of the crystalline core of the eosinophil granule. High levels of the proform of this protein are also present in placenta and pregnancy serum, where it exists as a complex with several other proteins including pregnancy-associated plasma protein A (PAPPA), angiotensinogen (AGT), and C3dg. This protein may be involved in antiparasitic defense mechanisms as a cytotoxin and helminthotoxin, and in immune hypersensitivity reactions. It is directly implicated in epithelial cell damage, exfoliation, and bronchospasm in allergic diseases. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Mouse(19074) proteoglycan 2, bone marrow
Rat(58826) proteoglycan 2, bone marrow
Horse(100062803) proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002728 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002728 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002728 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008920 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008920 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008920 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045031 MISSION® esiRNA esiRNA human PRG2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002728 Rosetta Predictions human pricing
NM_031619 Rosetta Predictions rat pricing
NM_008920 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00045479 predicted 401
2 SASI_Hs02_00334330 predicted 283
3 SASI_Hs01_00045480 predicted 289
4 SASI_Hs01_00045481 predicted 482
5 SASI_Hs01_00045482 predicted 473
6 SASI_Hs01_00045483 predicted 297
7 SASI_Hs01_00045484 predicted 459
8 SASI_Hs02_00334331 predicted 288
9 SASI_Hs01_00045485 predicted 400
10 SASI_Hs01_00045486 predicted 414
11 SASI_Hs01_00045487 predicted 477
12 SASI_Hs01_00045488 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031619 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090837 predicted 577
2 SASI_Rn01_00090838 predicted 470
3 SASI_Rn01_00090839 predicted 560
4 SASI_Rn02_00264922 predicted 463
5 SASI_Rn01_00090840 predicted 568
6 SASI_Rn01_00090841 predicted 468
7 SASI_Rn01_00090842 predicted 553
8 SASI_Rn01_00090843 predicted 581
9 SASI_Rn01_00090844 predicted 579
10 SASI_Rn01_00090846 predicted 557
11 SASI_Rn01_00090845 predicted 458
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008920 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038862 predicted 579
2 SASI_Mm01_00038863 predicted 388
3 SASI_Mm01_00038864 predicted 331
4 SASI_Mm01_00038865 predicted 553
5 SASI_Mm01_00038866 predicted 348
6 SASI_Mm01_00038867 predicted 561
7 SASI_Mm01_00038868 predicted 332
8 SASI_Mm01_00038869 predicted 282
9 SASI_Mm01_00038870 predicted 280
10 SASI_Mm01_00038871 predicted 550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002728
PRG2 MISSION shRNA Bacterial Glycerol Stock
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-535s21c1
Sequence:CCGGAGGGTCAAGTCTGGATTGGAGCTCGAGCTCCAATCCAGACTTGACCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-582s21c1
Sequence:CCGGAGACGCTTTCAGTGGGTTGACCTCGAGGTCAACCCACTGAAAGCGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-441s21c1
Sequence:CCGGTTTACTTGCCGGAGGTGCTACCTCGAGGTAGCACCTCCGGCAAGTAAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-470s1c1
Sequence:CCGGCCTGGTTTCCATCCACAACTTCTCGAGAAGTTGTGGATGGAAACCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-308s1c1
Sequence:CCGGAGTGCCAGATATGGTGGACAACTCGAGTTGTCCACCATATCTGGCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-715s1c1
Sequence:CCGGGAAGACTTCCTTTCATCTGTTCTCGAGAACAGATGAAAGGAAGTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-414s1c1
Sequence:CCGGAGTCTTCAGACGTTTAGTCAACTCGAGTTGACTAAACGTCTGAAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000062340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-343s1c1
Sequence:CCGGCTGAGGAAGAGGACACAGTAACTCGAGTTACTGTGTCCTCTTCCTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002728
PRG2 MISSION shRNA shRNA Plasmid DNA
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-535s21c1
Sequence:CCGGAGGGTCAAGTCTGGATTGGAGCTCGAGCTCCAATCCAGACTTGACCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-582s21c1
Sequence:CCGGAGACGCTTTCAGTGGGTTGACCTCGAGGTCAACCCACTGAAAGCGTCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-441s21c1
Sequence:CCGGTTTACTTGCCGGAGGTGCTACCTCGAGGTAGCACCTCCGGCAAGTAAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-470s1c1
Sequence:CCGGCCTGGTTTCCATCCACAACTTCTCGAGAAGTTGTGGATGGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-308s1c1
Sequence:CCGGAGTGCCAGATATGGTGGACAACTCGAGTTGTCCACCATATCTGGCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-715s1c1
Sequence:CCGGGAAGACTTCCTTTCATCTGTTCTCGAGAACAGATGAAAGGAAGTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-414s1c1
Sequence:CCGGAGTCTTCAGACGTTTAGTCAACTCGAGTTGACTAAACGTCTGAAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-343s1c1
Sequence:CCGGCTGAGGAAGAGGACACAGTAACTCGAGTTACTGTGTCCTCTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002728
PRG2 MISSION shRNA Lentiviral Transduction Particles
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436237    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-535s21c1
Sequence:CCGGAGGGTCAAGTCTGGATTGGAGCTCGAGCTCCAATCCAGACTTGACCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417676    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-582s21c1
Sequence:CCGGAGACGCTTTCAGTGGGTTGACCTCGAGGTCAACCCACTGAAAGCGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002728.4-441s21c1
Sequence:CCGGTTTACTTGCCGGAGGTGCTACCTCGAGGTAGCACCTCCGGCAAGTAAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-470s1c1
Sequence:CCGGCCTGGTTTCCATCCACAACTTCTCGAGAAGTTGTGGATGGAAACCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-308s1c1
Sequence:CCGGAGTGCCAGATATGGTGGACAACTCGAGTTGTCCACCATATCTGGCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-715s1c1
Sequence:CCGGGAAGACTTCCTTTCATCTGTTCTCGAGAACAGATGAAAGGAAGTCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-414s1c1
Sequence:CCGGAGTCTTCAGACGTTTAGTCAACTCGAGTTGACTAAACGTCTGAAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000062340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002728.4-343s1c1
Sequence:CCGGCTGAGGAAGAGGACACAGTAACTCGAGTTACTGTGTCCTCTTCCTCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008920
PRG2 MISSION shRNA Bacterial Glycerol Stock
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-556s1c1
Sequence:CCGGGCCGATGCAAACGCTTTCGATCTCGAGATCGAAAGCGTTTGCATCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-137s1c1
Sequence:CCGGCCCATTGATGGATGAGAACTTCTCGAGAAGTTCTCATCCATCAATGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-677s1c1
Sequence:CCGGGCGTCTATCTCACTGTGTCAACTCGAGTTGACACAGTGAGATAGACGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-464s1c1
Sequence:CCGGCCACAGTTTCAGTGTTAACTTCTCGAGAAGTTAACACTGAAACTGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000098723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-574s1c1
Sequence:CCGGGATGGGTTGATGGAAGTTCTTCTCGAGAAGAACTTCCATCAACCCATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008920
PRG2 MISSION shRNA shRNA Plasmid DNA
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-556s1c1
Sequence:CCGGGCCGATGCAAACGCTTTCGATCTCGAGATCGAAAGCGTTTGCATCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-137s1c1
Sequence:CCGGCCCATTGATGGATGAGAACTTCTCGAGAAGTTCTCATCCATCAATGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-677s1c1
Sequence:CCGGGCGTCTATCTCACTGTGTCAACTCGAGTTGACACAGTGAGATAGACGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-464s1c1
Sequence:CCGGCCACAGTTTCAGTGTTAACTTCTCGAGAAGTTAACACTGAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-574s1c1
Sequence:CCGGGATGGGTTGATGGAAGTTCTTCTCGAGAAGAACTTCCATCAACCCATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008920
PRG2 MISSION shRNA Lentiviral Transduction Particles
proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098724    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-556s1c1
Sequence:CCGGGCCGATGCAAACGCTTTCGATCTCGAGATCGAAAGCGTTTGCATCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-137s1c1
Sequence:CCGGCCCATTGATGGATGAGAACTTCTCGAGAAGTTCTCATCCATCAATGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-677s1c1
Sequence:CCGGGCGTCTATCTCACTGTGTCAACTCGAGTTGACACAGTGAGATAGACGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-464s1c1
Sequence:CCGGCCACAGTTTCAGTGTTAACTTCTCGAGAAGTTAACACTGAAACTGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000098723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008920.2-574s1c1
Sequence:CCGGGATGGGTTGATGGAAGTTCTTCTCGAGAAGAACTTCCATCAACCCATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)