EMAIL THIS PAGE TO A FRIEND

PRG4

proteoglycan 4

92 Gene Product Result for
Synonyms: CACP HAPO JCAP MSF SZP bG174L6.2
UniProtKB ID: Q92954, Q6DNC4, Q6DNC5, Q6ZMZ5, Q9BX49
Gene ID:
Human(23572) Summary: The protein encoded by this gene is a large proteoglycan specifically synthesized by chondrocytes located at the surface of articular cartilage, and also by some synovial lining cells. This protein contains both chondroitin sulfate and keratan sulfate glycosaminoglycans. It functions as a boundary lubricant at the cartilage surface and contributes to the elastic absorption and energy dissipation of synovial fluid. Mutations in this gene result in camptodactyly-arthropathy-coxa vara-pericarditis syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Human(10216) proteoglycan 4
Mouse(96875) proteoglycan 4 (megakaryocyte stimulating factor, articular superficial zone protein)
Rat(289104) proteoglycan 4
chicken(768493) proteoglycan 4
Horse(100034016) proteoglycan 4
domestic cat(101085684) proteoglycan 4
dog(664716) proteoglycan 4
cow(280867) proteoglycan 4
sheep(100294585) proteoglycan 4
sheep(101110076) proteoglycan 4
naked mole-rat(101697808) proteoglycan 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355243 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355243 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355243 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127708 Rosetta Predictions human pricing
NM_001127709 Rosetta Predictions human pricing
NM_001127710 Rosetta Predictions human pricing
NM_005807 Rosetta Predictions human pricing
NM_001105962 Rosetta Predictions rat pricing
NM_001110146 Rosetta Predictions mouse pricing
NM_021400 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127708 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330284 predicted 2816
2 SASI_Hs02_00330285 predicted 3186
3 SASI_Hs02_00330286 predicted 2597
4 SASI_Hs02_00330287 predicted 3346
5 SASI_Hs02_00330288 predicted 2693
6 SASI_Hs02_00330289 predicted 3317
7 SASI_Hs02_00330290 predicted 3401
8 SASI_Hs02_00330291 predicted 747
9 SASI_Hs02_00330292 predicted 3289
10 SASI_Hs02_00330293 predicted 3646
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330294 predicted 2450
2 SASI_Hs02_00330295 predicted 3199
3 SASI_Hs02_00330296 predicted 2536
4 SASI_Hs02_00330297 predicted 3242
5 SASI_Hs02_00330298 predicted 322
6 SASI_Hs02_00330299 predicted 3131
7 SASI_Hs02_00330300 predicted 3492
8 SASI_Hs02_00330301 predicted 3401
9 SASI_Hs02_00330302 predicted 2488
10 SASI_Hs02_00330303 predicted 2552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127710 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00330304 predicted 2540
2 SASI_Hs02_00330305 predicted 2320
3 SASI_Hs02_00330306 predicted 3068
4 SASI_Hs02_00330307 predicted 2419
5 SASI_Hs02_00330308 predicted 3121
6 SASI_Hs02_00330309 predicted 201
7 SASI_Hs02_00330310 predicted 3007
8 SASI_Hs02_00330311 predicted 3362
9 SASI_Hs02_00330312 predicted 3284
10 SASI_Hs02_00330313 predicted 2358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066117 predicted 2726
2 SASI_Hs01_00066118 predicted 3475
3 SASI_Hs01_00066119 predicted 2814
4 SASI_Hs02_00340319 predicted 3443
5 SASI_Hs02_00340320 predicted 838
6 SASI_Hs01_00066120 predicted 3523
7 SASI_Hs02_00340321 predicted 863
8 SASI_Hs01_00066122 predicted 3410
9 SASI_Hs02_00340322 predicted 3772
10 SASI_Hs02_00340323 predicted 3679
11 SASI_Hs01_00066121 predicted 4234
12 SASI_Hs01_00066123 predicted 4261
13 SASI_Hs01_00066124 predicted 4094
14 SASI_Hs01_00066125 predicted 2759
15 SASI_Hs01_00066126 predicted 2825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105962 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214262 predicted 3132
2 SASI_Rn02_00214263 predicted 1919
3 SASI_Rn02_00214264 predicted 3045
4 SASI_Rn02_00214265 predicted 2730
5 SASI_Rn02_00214266 predicted 889
6 SASI_Rn02_00214267 predicted 2555
7 SASI_Rn02_00214268 predicted 2986
8 SASI_Rn02_00214269 predicted 371
9 SASI_Rn02_00214270 predicted 3125
10 SASI_Rn02_00214271 predicted 998
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304726 predicted 728
2 SASI_Mm02_00304727 predicted 1165
3 SASI_Mm02_00304728 predicted 906
4 SASI_Mm02_00304729 predicted 893
5 SASI_Mm02_00304730 predicted 1295
6 SASI_Mm02_00304731 predicted 1147
7 SASI_Mm02_00304732 predicted 995
8 SASI_Mm02_00304733 predicted 754
9 SASI_Mm02_00304734 predicted 1056
10 SASI_Mm02_00304735 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021400 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326009 predicted 3124
2 SASI_Mm02_00326010 predicted 3556
3 SASI_Mm02_00326011 predicted 3302
4 SASI_Mm02_00326012 predicted 3288
5 SASI_Mm02_00326013 predicted 3689
6 SASI_Mm02_00326014 predicted 3541
7 SASI_Mm02_00326015 predicted 3389
8 SASI_Mm02_00326016 predicted 3155
9 SASI_Mm02_00326017 predicted 3451
10 SASI_Mm02_00326018 predicted 3495
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005807
PRG4 MISSION shRNA Bacterial Glycerol Stock
proteoglycan 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4257s1c1
Sequence:CCGGGCAAAGGAGGAGTCAACTAATCTCGAGATTAGTTGACTCCTCCTTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005807.1-3578s1c1
Sequence:CCGGCTCGCAGAATTACTGAAGTTTCTCGAGAAACTTCAGTAATTCTGCGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4666s1c1
Sequence:CCGGGTGACACAAGTACAATCTAAACTCGAGTTTAGATTGTACTTGTGTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4550s1c1
Sequence:CCGGGTGTATTCACTTACCCTAGTTCTCGAGAACTAGGGTAAGTGAATACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005807.1-3528s1c1
Sequence:CCGGCCGAGGTCATTATTTCTGGATCTCGAGATCCAGAAATAATGACCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005807
PRG4 MISSION shRNA shRNA Plasmid DNA
proteoglycan 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4257s1c1
Sequence:CCGGGCAAAGGAGGAGTCAACTAATCTCGAGATTAGTTGACTCCTCCTTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000150128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005807.1-3578s1c1
Sequence:CCGGCTCGCAGAATTACTGAAGTTTCTCGAGAAACTTCAGTAATTCTGCGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000183483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4666s1c1
Sequence:CCGGGTGACACAAGTACAATCTAAACTCGAGTTTAGATTGTACTTGTGTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000147341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4550s1c1
Sequence:CCGGGTGTATTCACTTACCCTAGTTCTCGAGAACTAGGGTAAGTGAATACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005807.1-3528s1c1
Sequence:CCGGCCGAGGTCATTATTTCTGGATCTCGAGATCCAGAAATAATGACCTCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005807
PRG4 MISSION shRNA Lentiviral Transduction Particles
proteoglycan 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179303    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4257s1c1
Sequence:CCGGGCAAAGGAGGAGTCAACTAATCTCGAGATTAGTTGACTCCTCCTTTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000150128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005807.1-3578s1c1
Sequence:CCGGCTCGCAGAATTACTGAAGTTTCTCGAGAAACTTCAGTAATTCTGCGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000183483    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4666s1c1
Sequence:CCGGGTGACACAAGTACAATCTAAACTCGAGTTTAGATTGTACTTGTGTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000147341    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005807.1-4550s1c1
Sequence:CCGGGTGTATTCACTTACCCTAGTTCTCGAGAACTAGGGTAAGTGAATACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005807.1-3528s1c1
Sequence:CCGGCCGAGGTCATTATTTCTGGATCTCGAGATCCAGAAATAATGACCTCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355243
PRG4 MISSION shRNA Bacterial Glycerol Stock
proteoglycan 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355243.3-3205s1c1
Sequence:CCGGTGATTGACAAAGAAGAGTCATCTCGAGATGACTCTTCTTTGTCAATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-1916s1c1
Sequence:CCGGGCAACAACTCTTGCACCCAAACTCGAGTTTGGGTGCAAGAGTTGTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-2559s1c1
Sequence:CCGGCCTCTCCTATTGACACAGTTTCTCGAGAAACTGTGTCAATAGGAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-827s1c1
Sequence:CCGGCCTAATTCTGAGACATCCAAACTCGAGTTTGGATGTCTCAGAATTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-3044s1c1
Sequence:CCGGGCGATAACACTGCCTAACATTCTCGAGAATGTTAGGCAGTGTTATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355243
PRG4 MISSION shRNA shRNA Plasmid DNA
proteoglycan 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355243.3-3205s1c1
Sequence:CCGGTGATTGACAAAGAAGAGTCATCTCGAGATGACTCTTCTTTGTCAATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-1916s1c1
Sequence:CCGGGCAACAACTCTTGCACCCAAACTCGAGTTTGGGTGCAAGAGTTGTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-2559s1c1
Sequence:CCGGCCTCTCCTATTGACACAGTTTCTCGAGAAACTGTGTCAATAGGAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-827s1c1
Sequence:CCGGCCTAATTCTGAGACATCCAAACTCGAGTTTGGATGTCTCAGAATTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000089085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-3044s1c1
Sequence:CCGGGCGATAACACTGCCTAACATTCTCGAGAATGTTAGGCAGTGTTATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355243
PRG4 MISSION shRNA Lentiviral Transduction Particles
proteoglycan 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_355243.3-3205s1c1
Sequence:CCGGTGATTGACAAAGAAGAGTCATCTCGAGATGACTCTTCTTTGTCAATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-1916s1c1
Sequence:CCGGGCAACAACTCTTGCACCCAAACTCGAGTTTGGGTGCAAGAGTTGTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-2559s1c1
Sequence:CCGGCCTCTCCTATTGACACAGTTTCTCGAGAAACTGTGTCAATAGGAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-827s1c1
Sequence:CCGGCCTAATTCTGAGACATCCAAACTCGAGTTTGGATGTCTCAGAATTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000089085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355243.3-3044s1c1
Sequence:CCGGGCGATAACACTGCCTAACATTCTCGAGAATGTTAGGCAGTGTTATCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)