EMAIL THIS PAGE TO A FRIEND

PRH1

proline-rich protein HaeIII subfamily 1

27 Gene Product Result for
Synonyms: PA
Species: Human PRH1(5554), Mouse Prh1(19131)
Gene ID:
Mouse(19131) proline rich protein HaeIII subfamily 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006250 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006250 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006250 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011174 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011174 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011174 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU230221 MISSION® esiRNA esiRNA targeting human PRH1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006250 Rosetta Predictions human pricing
NM_011174 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006250 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00023400 predicted 760
2 SASI_Hs02_00341180 predicted 697
3 SASI_Hs02_00341181 predicted 733
4 SASI_Hs01_00023409 predicted 671
5 SASI_Hs02_00341182 predicted 695
6 SASI_Hs02_00341183 predicted 691
7 SASI_Hs02_00341184 predicted 669
8 SASI_Hs02_00341185 predicted 715
9 SASI_Hs02_00341186 predicted 719
10 SASI_Hs02_00341187 predicted 694
11 SASI_Hs01_00023401 predicted 432
12 SASI_Hs01_00023402 predicted 217
13 SASI_Hs01_00023403 predicted 243
14 SASI_Hs01_00023404 predicted 313
15 SASI_Hs01_00023405 predicted 276
16 SASI_Hs01_00023406 predicted 150
17 SASI_Hs01_00023407 predicted 158
18 SASI_Hs01_00023408 predicted 88
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011174 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141290 predicted 537
2 SASI_Mm01_00141291 predicted 533
3 SASI_Mm01_00141292 predicted 532
4 SASI_Mm01_00141293 predicted 545
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006250
PRH1 MISSION shRNA Bacterial Glycerol Stock
proline-rich protein HaeIII subfamily 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-697s21c1
Sequence:CCGGGACTCTGAGCAGTTCCTAGATCTCGAGATCTAGGAACTGCTCAGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-133s1c1
Sequence:CCGGCCCTCGTAATATCAGATGGAGCTCGAGCTCCATCTGATATTACGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-111s1c1
Sequence:CCGGGATGTCAGCCAGGAAGATGTTCTCGAGAACATCTTCCTGGCTGACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-770s21c1
Sequence:CCGGGTGATGGGAACCAGGATGATGCTCGAGCATCATCCTGGTTCCCATCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-739s21c1
Sequence:CCGGTTGGGAGGACAGCAATCTCAACTCGAGTTGAGATTGCTGTCCTCCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-108s1c1
Sequence:CCGGGAAGATGTCAGCCAGGAAGATCTCGAGATCTTCCTGGCTGACATCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-134s1c1
Sequence:CCGGCCTCGTAATATCAGATGGAGGCTCGAGCCTCCATCTGATATTACGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-83s1c1
Sequence:CCGGCTTCAGCTCAGCTCAGGATTTCTCGAGAAATCCTGAGCTGAGCTGAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006250
PRH1 MISSION shRNA shRNA Plasmid DNA
proline-rich protein HaeIII subfamily 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-697s21c1
Sequence:CCGGGACTCTGAGCAGTTCCTAGATCTCGAGATCTAGGAACTGCTCAGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-133s1c1
Sequence:CCGGCCCTCGTAATATCAGATGGAGCTCGAGCTCCATCTGATATTACGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-111s1c1
Sequence:CCGGGATGTCAGCCAGGAAGATGTTCTCGAGAACATCTTCCTGGCTGACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-770s21c1
Sequence:CCGGGTGATGGGAACCAGGATGATGCTCGAGCATCATCCTGGTTCCCATCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-739s21c1
Sequence:CCGGTTGGGAGGACAGCAATCTCAACTCGAGTTGAGATTGCTGTCCTCCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-108s1c1
Sequence:CCGGGAAGATGTCAGCCAGGAAGATCTCGAGATCTTCCTGGCTGACATCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-134s1c1
Sequence:CCGGCCTCGTAATATCAGATGGAGGCTCGAGCCTCCATCTGATATTACGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000155803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-83s1c1
Sequence:CCGGCTTCAGCTCAGCTCAGGATTTCTCGAGAAATCCTGAGCTGAGCTGAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006250
PRH1 MISSION shRNA Lentiviral Transduction Particles
proline-rich protein HaeIII subfamily 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373241    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-697s21c1
Sequence:CCGGGACTCTGAGCAGTTCCTAGATCTCGAGATCTAGGAACTGCTCAGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-133s1c1
Sequence:CCGGCCCTCGTAATATCAGATGGAGCTCGAGCTCCATCTGATATTACGAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-111s1c1
Sequence:CCGGGATGTCAGCCAGGAAGATGTTCTCGAGAACATCTTCCTGGCTGACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-770s21c1
Sequence:CCGGGTGATGGGAACCAGGATGATGCTCGAGCATCATCCTGGTTCCCATCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373242    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006250.2-739s21c1
Sequence:CCGGTTGGGAGGACAGCAATCTCAACTCGAGTTGAGATTGCTGTCCTCCCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-108s1c1
Sequence:CCGGGAAGATGTCAGCCAGGAAGATCTCGAGATCTTCCTGGCTGACATCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-134s1c1
Sequence:CCGGCCTCGTAATATCAGATGGAGGCTCGAGCCTCCATCTGATATTACGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000155803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006250.1-83s1c1
Sequence:CCGGCTTCAGCTCAGCTCAGGATTTCTCGAGAAATCCTGAGCTGAGCTGAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011174
PRH1 MISSION shRNA Bacterial Glycerol Stock
proline-rich protein HaeIII subfamily 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-76s1c1
Sequence:CCGGCAAATCCAGATCCCAAATCAACTCGAGTTGATTTGGGATCTGGATTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-59s1c1
Sequence:CCGGGTGAAGAACTTCAGAATCAAACTCGAGTTTGATTCTGAAGTTCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-548s1c1
Sequence:CCGGCACAACCAAGACCTACTCAAGCTCGAGCTTGAGTAGGTCTTGGTTGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-70s1c1
Sequence:CCGGCAGAATCAAATCCAGATCCCACTCGAGTGGGATCTGGATTTGATTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-58s1c1
Sequence:CCGGCGTGAAGAACTTCAGAATCAACTCGAGTTGATTCTGAAGTTCTTCACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-57s1c1
Sequence:CCGGCCGTGAAGAACTTCAGAATCACTCGAGTGATTCTGAAGTTCTTCACGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-56s1c1
Sequence:CCGGCCCGTGAAGAACTTCAGAATCCTCGAGGATTCTGAAGTTCTTCACGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-118s1c1
Sequence:CCGGCAACCAAGACCGCCTGTTAATCTCGAGATTAACAGGCGGTCTTGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-82s1c1
Sequence:CCGGCAGATCCCAAATCAAAGGCCACTCGAGTGGCCTTTGATTTGGGATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-61s1c1
Sequence:CCGGGAAGAACTTCAGAATCAAATCCTCGAGGATTTGATTCTGAAGTTCTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011174
PRH1 MISSION shRNA shRNA Plasmid DNA
proline-rich protein HaeIII subfamily 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-76s1c1
Sequence:CCGGCAAATCCAGATCCCAAATCAACTCGAGTTGATTTGGGATCTGGATTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-59s1c1
Sequence:CCGGGTGAAGAACTTCAGAATCAAACTCGAGTTTGATTCTGAAGTTCTTCACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-548s1c1
Sequence:CCGGCACAACCAAGACCTACTCAAGCTCGAGCTTGAGTAGGTCTTGGTTGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000198166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-70s1c1
Sequence:CCGGCAGAATCAAATCCAGATCCCACTCGAGTGGGATCTGGATTTGATTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-58s1c1
Sequence:CCGGCGTGAAGAACTTCAGAATCAACTCGAGTTGATTCTGAAGTTCTTCACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-57s1c1
Sequence:CCGGCCGTGAAGAACTTCAGAATCACTCGAGTGATTCTGAAGTTCTTCACGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-56s1c1
Sequence:CCGGCCCGTGAAGAACTTCAGAATCCTCGAGGATTCTGAAGTTCTTCACGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-118s1c1
Sequence:CCGGCAACCAAGACCGCCTGTTAATCTCGAGATTAACAGGCGGTCTTGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000182074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-82s1c1
Sequence:CCGGCAGATCCCAAATCAAAGGCCACTCGAGTGGCCTTTGATTTGGGATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000177357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-61s1c1
Sequence:CCGGGAAGAACTTCAGAATCAAATCCTCGAGGATTTGATTCTGAAGTTCTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011174
PRH1 MISSION shRNA Lentiviral Transduction Particles
proline-rich protein HaeIII subfamily 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197624    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-76s1c1
Sequence:CCGGCAAATCCAGATCCCAAATCAACTCGAGTTGATTTGGGATCTGGATTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177169    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-59s1c1
Sequence:CCGGGTGAAGAACTTCAGAATCAAACTCGAGTTTGATTCTGAAGTTCTTCACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200020    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-548s1c1
Sequence:CCGGCACAACCAAGACCTACTCAAGCTCGAGCTTGAGTAGGTCTTGGTTGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000198166    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-70s1c1
Sequence:CCGGCAGAATCAAATCCAGATCCCACTCGAGTGGGATCTGGATTTGATTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-58s1c1
Sequence:CCGGCGTGAAGAACTTCAGAATCAACTCGAGTTGATTCTGAAGTTCTTCACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-57s1c1
Sequence:CCGGCCGTGAAGAACTTCAGAATCACTCGAGTGATTCTGAAGTTCTTCACGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-56s1c1
Sequence:CCGGCCCGTGAAGAACTTCAGAATCCTCGAGGATTCTGAAGTTCTTCACGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-118s1c1
Sequence:CCGGCAACCAAGACCGCCTGTTAATCTCGAGATTAACAGGCGGTCTTGGTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-82s1c1
Sequence:CCGGCAGATCCCAAATCAAAGGCCACTCGAGTGGCCTTTGATTTGGGATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000177357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011174.2-61s1c1
Sequence:CCGGGAAGAACTTCAGAATCAAATCCTCGAGGATTTGATTCTGAAGTTCTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)