EMAIL THIS PAGE TO A FRIEND

PRH2

proline-rich protein HaeIII subfamily 2

80 Gene Product Result for
Synonyms: PIF-S PRH1 PRP-1/PRP-2 Pr db-s pa pr1/Pr2
Species: Human PRH2(5555)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301902 Anti-PRH2 affinity isolated antibody human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005042 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001110213 Rosetta Predictions human pricing
NM_005042 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110213 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00324855 predicted 888
2 SASI_Hs02_00324856 predicted 885
3 SASI_Hs02_00324857 predicted 930
4 SASI_Hs02_00324858 predicted 955
5 SASI_Hs02_00324859 predicted 873
6 SASI_Hs02_00324860 predicted 931
7 SASI_Hs02_00324861 predicted 987
8 SASI_Hs02_00324862 predicted 879
9 SASI_Hs02_00324863 predicted 947
10 SASI_Hs02_00324864 predicted 765
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171059 predicted 554
2 SASI_Hs02_00338840 predicted 765
3 SASI_Hs01_00171062 predicted 598
4 SASI_Hs01_00171064 predicted 780
5 SASI_Hs01_00171065 predicted 946
6 SASI_Hs01_00171067 predicted 610
7 SASI_Hs01_00171068 predicted 562
8 SASI_Hs02_00338841 predicted 559
9 SASI_Hs02_00338842 predicted 696
10 SASI_Hs02_00338843 predicted 791
11 SASI_Hs01_00171060 predicted 757
12 SASI_Hs01_00171061 predicted 855
13 SASI_Hs01_00171063 predicted 1019
14 SASI_Hs01_00171066 predicted 556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005042
PRH2 MISSION shRNA Bacterial Glycerol Stock
proline-rich protein HaeIII subfamily 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-558s21c1
Sequence:CCGGGGTATGATTCCAGTTTATTATCTCGAGATAATAAACTGGAATCATACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-547s21c1
Sequence:CCGGATTCAATGATAGGTATGATTCCTCGAGGAATCATACCTATCATTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-129s1c1
Sequence:CCGGGTTCCCTTGGTAATATCAGATCTCGAGATCTGATATTACCAAGGGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-852s21c1
Sequence:CCGGACTCAAAGACTCCCATTTATTCTCGAGAATAAATGGGAGTCTTTGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-93s1c1
Sequence:CCGGGCTCAGGACTTAGATGAAGATCTCGAGATCTTCATCTAAGTCCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-132s1c1
Sequence:CCGGCCCTTGGTAATATCAGATGGACTCGAGTCCATCTGATATTACCAAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-126s1c1
Sequence:CCGGGACGTTCCCTTGGTAATATCACTCGAGTGATATTACCAAGGGAACGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.2-115s1c1
Sequence:CCGGCAAGAAGACGTTCCCTTGGTACTCGAGTACCAAGGGAACGTCTTCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005042
PRH2 MISSION shRNA shRNA Plasmid DNA
proline-rich protein HaeIII subfamily 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-558s21c1
Sequence:CCGGGGTATGATTCCAGTTTATTATCTCGAGATAATAAACTGGAATCATACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-547s21c1
Sequence:CCGGATTCAATGATAGGTATGATTCCTCGAGGAATCATACCTATCATTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000151600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-129s1c1
Sequence:CCGGGTTCCCTTGGTAATATCAGATCTCGAGATCTGATATTACCAAGGGAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-852s21c1
Sequence:CCGGACTCAAAGACTCCCATTTATTCTCGAGAATAAATGGGAGTCTTTGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-93s1c1
Sequence:CCGGGCTCAGGACTTAGATGAAGATCTCGAGATCTTCATCTAAGTCCTGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000178983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-132s1c1
Sequence:CCGGCCCTTGGTAATATCAGATGGACTCGAGTCCATCTGATATTACCAAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000179334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-126s1c1
Sequence:CCGGGACGTTCCCTTGGTAATATCACTCGAGTGATATTACCAAGGGAACGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000154342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.2-115s1c1
Sequence:CCGGCAAGAAGACGTTCCCTTGGTACTCGAGTACCAAGGGAACGTCTTCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005042
PRH2 MISSION shRNA Lentiviral Transduction Particles
proline-rich protein HaeIII subfamily 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373294    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-558s21c1
Sequence:CCGGGGTATGATTCCAGTTTATTATCTCGAGATAATAAACTGGAATCATACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373243    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-547s21c1
Sequence:CCGGATTCAATGATAGGTATGATTCCTCGAGGAATCATACCTATCATTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-129s1c1
Sequence:CCGGGTTCCCTTGGTAATATCAGATCTCGAGATCTGATATTACCAAGGGAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005042.4-852s21c1
Sequence:CCGGACTCAAAGACTCCCATTTATTCTCGAGAATAAATGGGAGTCTTTGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-93s1c1
Sequence:CCGGGCTCAGGACTTAGATGAAGATCTCGAGATCTTCATCTAAGTCCTGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000178983    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-132s1c1
Sequence:CCGGCCCTTGGTAATATCAGATGGACTCGAGTCCATCTGATATTACCAAGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.1-126s1c1
Sequence:CCGGGACGTTCCCTTGGTAATATCACTCGAGTGATATTACCAAGGGAACGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000154342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005042.2-115s1c1
Sequence:CCGGCAAGAAGACGTTCCCTTGGTACTCGAGTACCAAGGGAACGTCTTCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)