EMAIL THIS PAGE TO A FRIEND

PRICKLE1

prickle homolog 1 (Drosophila)

93 Gene Product Result for
Synonyms: EPM1B RILP
UniProtKB ID: Q96MT3, Q14C83, Q71QF8, Q96N00
Gene ID:
Human(144165) Summary: This gene encodes a nuclear receptor that may be a negative regulator of the Wnt/beta-catenin signaling pathway. The encoded protein localizes to the nuclear membrane and has been implicated in the nuclear trafficking of the transcription repressors REST/NRSF and REST4. Mutations in this gene have been linked to progressive myoclonus epilepsy. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 3. [provided by RefSeq, Sep 2009]
Mouse(106042) prickle homolog 1 (Drosophila)
Rat(315259) prickle homolog 1 (Drosophila)
cow(785152) prickle homolog 1 (Drosophila)
sheep(101115695) prickle homolog 1 (Drosophila)
naked mole-rat(101700621) prickle homolog 1 (Drosophila)
domestic guinea pig(100715344) prickle homolog 1 (Drosophila)
chicken(417793) prickle homolog 1 (Drosophila)
dog(477638) prickle homolog 1 (Drosophila)
domestic cat(101098966) prickle homolog 1 (Drosophila)
Horse(100050052) prickle homolog 1 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033217 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033217 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033217 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_153026 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153026 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153026 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU022711 MISSION® esiRNA esiRNA human PRICKLE1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153026 Rosetta Predictions human pricing
XM_001057421 Rosetta Predictions rat pricing
XM_001057488 Rosetta Predictions rat pricing
XM_001075319 Rosetta Predictions rat pricing
XM_235609 Rosetta Predictions rat pricing
NM_001033217 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00089289 predicted 1216
2 SASI_Hs01_00089290 predicted 2757
3 SASI_Hs01_00089291 predicted 317
4 SASI_Hs01_00089292 predicted 550
5 SASI_Hs01_00089293 predicted 2625
6 SASI_Hs01_00089294 predicted 1234
7 SASI_Hs01_00089295 predicted 2632
8 SASI_Hs01_00089296 predicted 443
9 SASI_Hs02_00366983 predicted 1290
10 SASI_Hs01_00089297 predicted 2035
11 SASI_Hs01_00089298 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057421 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286277 predicted 1329
2 SASI_Rn02_00286278 predicted 879
3 SASI_Rn02_00286279 predicted 746
4 SASI_Rn02_00286280 predicted 2536
5 SASI_Rn02_00286281 predicted 2518
6 SASI_Rn02_00286282 predicted 2304
7 SASI_Rn02_00286283 predicted 2471
8 SASI_Rn02_00286284 predicted 1159
9 SASI_Rn02_00286285 predicted 1907
10 SASI_Rn02_00286286 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057488 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00286537 predicted 1587
2 SASI_Rn02_00286538 predicted 1143
3 SASI_Rn02_00286539 predicted 1000
4 SASI_Rn02_00286540 predicted 2799
5 SASI_Rn02_00286541 predicted 2778
6 SASI_Rn02_00286542 predicted 2559
7 SASI_Rn02_00286543 predicted 2725
8 SASI_Rn02_00286544 predicted 2168
9 SASI_Rn02_00286545 predicted 1983
10 SASI_Rn02_00286546 predicted 2373
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075319 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00349320 predicted 884
2 SASI_Rn02_00349321 predicted 1221
3 SASI_Rn02_00349322 predicted 739
4 SASI_Rn02_00349323 predicted 1837
5 SASI_Rn02_00349324 predicted 968
6 SASI_Rn02_00349325 predicted 2006
7 SASI_Rn02_00349326 predicted 1220
8 SASI_Rn02_00349327 predicted 1939
9 SASI_Rn02_00349328 predicted 934
10 SASI_Rn02_00349329 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389516 predicted 1135
2 SASI_Rn02_00389517 predicted 1480
3 SASI_Rn02_00389518 predicted 1005
4 SASI_Rn02_00389519 predicted 2103
5 SASI_Rn02_00389520 predicted 1226
6 SASI_Rn02_00389521 predicted 2255
7 SASI_Rn02_00389522 predicted 1474
8 SASI_Rn02_00389523 predicted 2194
9 SASI_Rn02_00389524 predicted 1184
10 SASI_Rn02_00389525 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033217 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00149592 predicted 1462
2 SASI_Mm02_00288339 predicted 2382
3 SASI_Mm01_00149594 predicted 1136
4 SASI_Mm01_00149596 predicted 1795
5 SASI_Mm01_00149597 predicted 2783
6 SASI_Mm01_00149598 predicted 1136
7 SASI_Mm01_00149599 predicted 2417
8 SASI_Mm01_00149600 predicted 2753
9 SASI_Mm01_00149601 predicted 1403
10 SASI_Mm02_00288340 predicted 2730
11 SASI_Mm01_00149593 predicted 2571
12 SASI_Mm01_00149595 predicted 2625
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033217
VALIDATED
PRICKLE1 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033217.4-2458s1c1
Sequence:CCGGTGCCCATGCCACGTCTGATTACTCGAGTAATCAGACGTGGCATGGGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033217.4-3379s21c1
Sequence:CCGGTTACACTGCCATGCTAGATTTCTCGAGAAATCTAGCATGGCAGTGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-2134s21c1
Sequence:CCGGCCGACCACAGCAGGTCAAATTCTCGAGAATTTGACCTGCTGTGGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033217.4-2909s1c1
Sequence:CCGGCCAGTCTTGGTGCCATATTAACTCGAGTTAATATGGCACCAAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-1916s1c1
Sequence:CCGGAGCAAGCCAAGACCGTCATTACTCGAGTAATGACGGTCTTGGCTTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-719s1c1
Sequence:CCGGTTTGTCTGCTTCACGTGTAATCTCGAGATTACACGTGAAGCAGACAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-1592s1c1
Sequence:CCGGGACAACATGGTTACGAATAAGCTCGAGCTTATTCGTAACCATGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-1847s21c1
Sequence:CCGGCAGAGTATCCGGGATTCTATGCTCGAGCATAGAATCCCGGATACTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033217.4-2176s21c1
Sequence:CCGGCGGAAGCTACGACATCGAAATCTCGAGATTTCGATGTCGTAGCTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-476s21c1
Sequence:CCGGCAGTTGCCTCCACACGATAACCTCGAGGTTATCGTGTGGAGGCAACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033217
VALIDATED
PRICKLE1 MISSION shRNA shRNA Plasmid DNA
prickle homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033217.4-2458s1c1
Sequence:CCGGTGCCCATGCCACGTCTGATTACTCGAGTAATCAGACGTGGCATGGGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033217.4-3379s21c1
Sequence:CCGGTTACACTGCCATGCTAGATTTCTCGAGAAATCTAGCATGGCAGTGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-2134s21c1
Sequence:CCGGCCGACCACAGCAGGTCAAATTCTCGAGAATTTGACCTGCTGTGGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033217.4-2909s1c1
Sequence:CCGGCCAGTCTTGGTGCCATATTAACTCGAGTTAATATGGCACCAAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-1916s1c1
Sequence:CCGGAGCAAGCCAAGACCGTCATTACTCGAGTAATGACGGTCTTGGCTTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-719s1c1
Sequence:CCGGTTTGTCTGCTTCACGTGTAATCTCGAGATTACACGTGAAGCAGACAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-1592s1c1
Sequence:CCGGGACAACATGGTTACGAATAAGCTCGAGCTTATTCGTAACCATGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-1847s21c1
Sequence:CCGGCAGAGTATCCGGGATTCTATGCTCGAGCATAGAATCCCGGATACTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033217.4-2176s21c1
Sequence:CCGGCGGAAGCTACGACATCGAAATCTCGAGATTTCGATGTCGTAGCTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-476s21c1
Sequence:CCGGCAGTTGCCTCCACACGATAACCTCGAGGTTATCGTGTGGAGGCAACTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033217
VALIDATED
PRICKLE1 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001033217.4-2458s1c1
Sequence:CCGGTGCCCATGCCACGTCTGATTACTCGAGTAATCAGACGTGGCATGGGCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241978    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033217.4-3379s21c1
Sequence:CCGGTTACACTGCCATGCTAGATTTCTCGAGAAATCTAGCATGGCAGTGTAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-2134s21c1
Sequence:CCGGCCGACCACAGCAGGTCAAATTCTCGAGAATTTGACCTGCTGTGGTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219485    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001033217.4-2909s1c1
Sequence:CCGGCCAGTCTTGGTGCCATATTAACTCGAGTTAATATGGCACCAAGACTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-1916s1c1
Sequence:CCGGAGCAAGCCAAGACCGTCATTACTCGAGTAATGACGGTCTTGGCTTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-719s1c1
Sequence:CCGGTTTGTCTGCTTCACGTGTAATCTCGAGATTACACGTGAAGCAGACAAATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000219482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_001033217.4-1592s1c1
Sequence:CCGGGACAACATGGTTACGAATAAGCTCGAGCTTATTCGTAACCATGTTGTCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-1847s21c1
Sequence:CCGGCAGAGTATCCGGGATTCTATGCTCGAGCATAGAATCCCGGATACTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001033217.4-2176s21c1
Sequence:CCGGCGGAAGCTACGACATCGAAATCTCGAGATTTCGATGTCGTAGCTTCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000241979    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033217.4-476s21c1
Sequence:CCGGCAGTTGCCTCCACACGATAACCTCGAGGTTATCGTGTGGAGGCAACTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153026
VALIDATED
PRICKLE1 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-2316s1c1
Sequence:CCGGGCCCTGAATCTTGTTACAGAACTCGAGTTCTGTAACAAGATTCAGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_153026.1-489s1c1
Sequence:CCGGCCACCACATGATAATGAGGTACTCGAGTACCTCATTATCATGTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-2635s1c1
Sequence:CCGGCCTACTATACAGATGACCTTTCTCGAGAAAGGTCATCTGTATAGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_153026.1-1846s1c1
Sequence:CCGGCAGAGCAAAGTGTTCGGGATTCTCGAGAATCCCGAACACTTTGCTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000017403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-832s1c1
Sequence:CCGGGCTCAGCATGTGACGAGATAACTCGAGTTATCTCGTCACATGCTGAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000352794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-2410s21c1
Sequence:CCGGGCCCTGAATCTTGTTACAGAACTCGAGTTCTGTAACAAGATTCAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-1940s21c1
Sequence:CCGGCAGAGCAAAGTGTTCGGGATTCTCGAGAATCCCGAACACTTTGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-2729s21c1
Sequence:CCGGCCTACTATACAGATGACCTTTCTCGAGAAAGGTCATCTGTATAGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000342935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-926s21c1
Sequence:CCGGGCTCAGCATGTGACGAGATAACTCGAGTTATCTCGTCACATGCTGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153026
VALIDATED
PRICKLE1 MISSION shRNA shRNA Plasmid DNA
prickle homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-2316s1c1
Sequence:CCGGGCCCTGAATCTTGTTACAGAACTCGAGTTCTGTAACAAGATTCAGGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_153026.1-489s1c1
Sequence:CCGGCCACCACATGATAATGAGGTACTCGAGTACCTCATTATCATGTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-2635s1c1
Sequence:CCGGCCTACTATACAGATGACCTTTCTCGAGAAAGGTCATCTGTATAGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_153026.1-1846s1c1
Sequence:CCGGCAGAGCAAAGTGTTCGGGATTCTCGAGAATCCCGAACACTTTGCTCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000017403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-832s1c1
Sequence:CCGGGCTCAGCATGTGACGAGATAACTCGAGTTATCTCGTCACATGCTGAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000352794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-2410s21c1
Sequence:CCGGGCCCTGAATCTTGTTACAGAACTCGAGTTCTGTAACAAGATTCAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-1940s21c1
Sequence:CCGGCAGAGCAAAGTGTTCGGGATTCTCGAGAATCCCGAACACTTTGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-2729s21c1
Sequence:CCGGCCTACTATACAGATGACCTTTCTCGAGAAAGGTCATCTGTATAGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000342935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-926s21c1
Sequence:CCGGGCTCAGCATGTGACGAGATAACTCGAGTTATCTCGTCACATGCTGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153026
VALIDATED
PRICKLE1 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-2316s1c1
Sequence:CCGGGCCCTGAATCTTGTTACAGAACTCGAGTTCTGTAACAAGATTCAGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017405    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_153026.1-489s1c1
Sequence:CCGGCCACCACATGATAATGAGGTACTCGAGTACCTCATTATCATGTGGTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017406    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-2635s1c1
Sequence:CCGGCCTACTATACAGATGACCTTTCTCGAGAAAGGTCATCTGTATAGTAGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_153026.1-1846s1c1
Sequence:CCGGCAGAGCAAAGTGTTCGGGATTCTCGAGAATCCCGAACACTTTGCTCTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000017403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153026.1-832s1c1
Sequence:CCGGGCTCAGCATGTGACGAGATAACTCGAGTTATCTCGTCACATGCTGAGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000352794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-2410s21c1
Sequence:CCGGGCCCTGAATCTTGTTACAGAACTCGAGTTCTGTAACAAGATTCAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-1940s21c1
Sequence:CCGGCAGAGCAAAGTGTTCGGGATTCTCGAGAATCCCGAACACTTTGCTCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342937    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-2729s21c1
Sequence:CCGGCCTACTATACAGATGACCTTTCTCGAGAAAGGTCATCTGTATAGTAGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000342935    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153026.2-926s21c1
Sequence:CCGGGCTCAGCATGTGACGAGATAACTCGAGTTATCTCGTCACATGCTGAGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???