EMAIL THIS PAGE TO A FRIEND

PRICKLE2

prickle homolog 2 (Drosophila)

252 Gene Product Result for
Synonyms: EPM5
UniProtKB ID: Q7Z3G6, Q0VF44
Gene ID:
Human(166336) Summary: This gene encodes a homolog of Drosophila prickle. The exact function of this gene is not known, however, studies in mice suggest that it may be involved in seizure prevention. Mutations in this gene are associated with progressive myoclonic epilepsy type 5. [provided by RefSeq, Dec 2011]
Mouse(243548) prickle homolog 2 (Drosophila)
Rat(312563) prickle homolog 2 (Drosophila)
Zebrafish(368250) prickle-like 2 (Drosophila)
chicken(771427) prickle homolog 2 (Drosophila)
Horse(100049951) prickle homolog 2 (Drosophila)
domestic cat(101086637) prickle homolog 2 (Drosophila)
dog(484699) prickle homolog 2 (Drosophila)
domestic guinea pig(100715766) prickle homolog 2 (Drosophila)
naked mole-rat(101702207) prickle homolog 2 (Drosophila)
cow(537192) prickle homolog 2 (Drosophila)
sheep(101106372) prickle homolog 2 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035493 Anti-PRICKLE2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunohistochemistry, western blot pricing
SAB3500692 Anti-PRICKLE2 antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001134461 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001134461 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001134461 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_198859 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198859 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198859 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_144905 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_144905 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_144905 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198859 Rosetta Predictions human pricing
NM_001107876 Rosetta Predictions rat pricing
NM_001081146 Rosetta Predictions mouse pricing
XM_144905 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198859 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179630 predicted 2344
2 SASI_Hs01_00179631 predicted 3141
3 SASI_Hs01_00179632 predicted 2753
4 SASI_Hs01_00179633 predicted 753
5 SASI_Hs01_00179634 predicted 3049
6 SASI_Hs01_00179635 predicted 795
7 SASI_Hs01_00179636 predicted 1528
8 SASI_Hs01_00179637 predicted 2356
9 SASI_Hs01_00179638 predicted 2876
10 SASI_Hs01_00179639 predicted 1544
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107876 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233155 predicted 325
2 SASI_Rn02_00233156 predicted 2540
3 SASI_Rn02_00233157 predicted 2430
4 SASI_Rn02_00233158 predicted 2716
5 SASI_Rn02_00233159 predicted 2647
6 SASI_Rn02_00233160 predicted 2722
7 SASI_Rn02_00233161 predicted 907
8 SASI_Rn02_00233162 predicted 1869
9 SASI_Rn02_00233163 predicted 2435
10 SASI_Rn02_00233164 predicted 288
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081146 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00295631 predicted 1726
2 SASI_Mm02_00295632 predicted 406
3 SASI_Mm02_00295633 predicted 2506
4 SASI_Mm02_00295634 predicted 1979
5 SASI_Mm02_00295635 predicted 989
6 SASI_Mm02_00295636 predicted 1513
7 SASI_Mm02_00295637 predicted 1942
8 SASI_Mm02_00295638 predicted 2511
9 SASI_Mm02_00295639 predicted 2221
10 SASI_Mm02_00295640 predicted 1833
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_144905 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00271116 predicted 1733
2 SASI_Mm01_00271117 predicted 411
3 SASI_Mm01_00271118 predicted 2506
4 SASI_Mm01_00271119 predicted 1984
5 SASI_Mm01_00271120 predicted 1731
6 SASI_Mm01_00271121 predicted 995
7 SASI_Mm01_00271122 predicted 1944
8 SASI_Mm01_00271123 predicted 2520
9 SASI_Mm01_00271124 predicted 2222
10 SASI_Mm01_00271125 predicted 1845
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001134461
PRICKLE2 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 2 (Drosophila)
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000452902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134461.1-2899s21c1
Sequence:CCGGCAAGGTGGAGTGGCCATTAACCTCGAGGTTAATGGCCACTCCACCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134461.1-3035s21c1
Sequence:CCGGTCATTGTAAATGCGATGTAAACTCGAGTTTACATCGCATTTACAATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134461.1-2407s21c1
Sequence:CCGGCTACTTCACGGAGTATGATTGCTCGAGCAATCATACTCCGTGAAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001134461
PRICKLE2 MISSION shRNA shRNA Plasmid DNA
prickle homolog 2 (Drosophila)
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000452902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134461.1-2899s21c1
Sequence:CCGGCAAGGTGGAGTGGCCATTAACCTCGAGGTTAATGGCCACTCCACCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000440572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134461.1-3035s21c1
Sequence:CCGGTCATTGTAAATGCGATGTAAACTCGAGTTTACATCGCATTTACAATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000442592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134461.1-2407s21c1
Sequence:CCGGCTACTTCACGGAGTATGATTGCTCGAGCAATCATACTCCGTGAAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001134461
PRICKLE2 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 2 (Drosophila)
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000452902    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134461.1-2899s21c1
Sequence:CCGGCAAGGTGGAGTGGCCATTAACCTCGAGGTTAATGGCCACTCCACCTTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000440572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001134461.1-3035s21c1
Sequence:CCGGTCATTGTAAATGCGATGTAAACTCGAGTTTACATCGCATTTACAATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000442592    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001134461.1-2407s21c1
Sequence:CCGGCTACTTCACGGAGTATGATTGCTCGAGCAATCATACTCCGTGAAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198859
PRICKLE2 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-3003s21c1
Sequence:CCGGGCGATGAGCTGCTGCACAAATCTCGAGATTTGTGCAGCAGCTCATCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-2935s21c1
Sequence:CCGGGTCTGACAACGAGGGCTATTTCTCGAGAAATAGCCCTCGTTGTCAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-2746s21c1
Sequence:CCGGGGAGGACTATGACCAATTTATCTCGAGATAAATTGGTCATAGTCCTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-834s21c1
Sequence:CCGGATGACAATGAGGTTCGATATTCTCGAGAATATCGAACCTCATTGTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198859.1-4427s1c1
Sequence:CCGGCCAGCTTAGTAACCAGAGTATCTCGAGATACTCTGGTTACTAAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-756s1c1
Sequence:CCGGCCAGAAGAGAAAGTCCCTTATCTCGAGATAAGGGACTTTCTCTTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1784s1c1
Sequence:CCGGGCCCTACCATTATGGGAACAACTCGAGTTGTTCCCATAATGGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1328s1c1
Sequence:CCGGCGAGTCCTTGTATGCAGAATACTCGAGTATTCTGCATACAAGGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1329s1c1
Sequence:CCGGGAGTCCTTGTATGCAGAATATCTCGAGATATTCTGCATACAAGGACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198859
PRICKLE2 MISSION shRNA shRNA Plasmid DNA
prickle homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-3003s21c1
Sequence:CCGGGCGATGAGCTGCTGCACAAATCTCGAGATTTGTGCAGCAGCTCATCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000421260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-2935s21c1
Sequence:CCGGGTCTGACAACGAGGGCTATTTCTCGAGAAATAGCCCTCGTTGTCAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-2746s21c1
Sequence:CCGGGGAGGACTATGACCAATTTATCTCGAGATAAATTGGTCATAGTCCTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-834s21c1
Sequence:CCGGATGACAATGAGGTTCGATATTCTCGAGAATATCGAACCTCATTGTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198859.1-4427s1c1
Sequence:CCGGCCAGCTTAGTAACCAGAGTATCTCGAGATACTCTGGTTACTAAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-756s1c1
Sequence:CCGGCCAGAAGAGAAAGTCCCTTATCTCGAGATAAGGGACTTTCTCTTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1784s1c1
Sequence:CCGGGCCCTACCATTATGGGAACAACTCGAGTTGTTCCCATAATGGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1328s1c1
Sequence:CCGGCGAGTCCTTGTATGCAGAATACTCGAGTATTCTGCATACAAGGACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000117230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1329s1c1
Sequence:CCGGGAGTCCTTGTATGCAGAATATCTCGAGATATTCTGCATACAAGGACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198859
PRICKLE2 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 2 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-3003s21c1
Sequence:CCGGGCGATGAGCTGCTGCACAAATCTCGAGATTTGTGCAGCAGCTCATCGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000421260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-2935s21c1
Sequence:CCGGGTCTGACAACGAGGGCTATTTCTCGAGAAATAGCCCTCGTTGTCAGACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-2746s21c1
Sequence:CCGGGGAGGACTATGACCAATTTATCTCGAGATAAATTGGTCATAGTCCTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198859.3-834s21c1
Sequence:CCGGATGACAATGAGGTTCGATATTCTCGAGAATATCGAACCTCATTGTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198859.1-4427s1c1
Sequence:CCGGCCAGCTTAGTAACCAGAGTATCTCGAGATACTCTGGTTACTAAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-756s1c1
Sequence:CCGGCCAGAAGAGAAAGTCCCTTATCTCGAGATAAGGGACTTTCTCTTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1784s1c1
Sequence:CCGGGCCCTACCATTATGGGAACAACTCGAGTTGTTCCCATAATGGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1328s1c1
Sequence:CCGGCGAGTCCTTGTATGCAGAATACTCGAGTATTCTGCATACAAGGACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000117230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198859.1-1329s1c1
Sequence:CCGGGAGTCCTTGTATGCAGAATATCTCGAGATATTCTGCATACAAGGACTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_144905
PRICKLE2 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-1952s1c1
Sequence:CCGGCCCTAAGAGAAGCTCATCAATCTCGAGATTGATGAGCTTCTCTTAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-1464s1c1
Sequence:CCGGGCTCATTGTAAGAAGTCTCTTCTCGAGAAGAGACTTCTTACAATGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_144905.5-3180s1c1
Sequence:CCGGGCTAAGAATGTAAACTCAGAACTCGAGTTCTGAGTTTACATTCTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-3038s1c1
Sequence:CCGGCCTGCACAAATACAGCTCTTACTCGAGTAAGAGCTGTATTTGTGCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-855s1c1
Sequence:CCGGCATGACAATGAGGTTCGGTATCTCGAGATACCGAACCTCATTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_144905
PRICKLE2 MISSION shRNA shRNA Plasmid DNA
prickle homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-1952s1c1
Sequence:CCGGCCCTAAGAGAAGCTCATCAATCTCGAGATTGATGAGCTTCTCTTAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-1464s1c1
Sequence:CCGGGCTCATTGTAAGAAGTCTCTTCTCGAGAAGAGACTTCTTACAATGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_144905.5-3180s1c1
Sequence:CCGGGCTAAGAATGTAAACTCAGAACTCGAGTTCTGAGTTTACATTCTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-3038s1c1
Sequence:CCGGCCTGCACAAATACAGCTCTTACTCGAGTAAGAGCTGTATTTGTGCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-855s1c1
Sequence:CCGGCATGACAATGAGGTTCGGTATCTCGAGATACCGAACCTCATTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_144905
PRICKLE2 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-1952s1c1
Sequence:CCGGCCCTAAGAGAAGCTCATCAATCTCGAGATTGATGAGCTTCTCTTAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-1464s1c1
Sequence:CCGGGCTCATTGTAAGAAGTCTCTTCTCGAGAAGAGACTTCTTACAATGAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091048    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:XM_144905.5-3180s1c1
Sequence:CCGGGCTAAGAATGTAAACTCAGAACTCGAGTTCTGAGTTTACATTCTTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091049    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-3038s1c1
Sequence:CCGGCCTGCACAAATACAGCTCTTACTCGAGTAAGAGCTGTATTTGTGCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091052    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_144905.5-855s1c1
Sequence:CCGGCATGACAATGAGGTTCGGTATCTCGAGATACCGAACCTCATTGTCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)