EMAIL THIS PAGE TO A FRIEND

PRICKLE4

prickle homolog 4 (Drosophila)

64 Gene Product Result for
Synonyms: C6orf49 OBTP OEBT TOMM6
UniProtKB ID: Q2TBC4, A2A3M0, A6PVU1, B3KQ15, Q5T3D4, Q9NSV1
Gene ID:
Human(29964) Summary: C6ORF49 is a member of the LIM domain protein family (Teufel et al., 2005 [PubMed 15702247]
Mouse(381104) prickle homolog 4 (Drosophila)
Rat(316212) prickle homolog 4 (Drosophila)
domestic guinea pig(100719340) prickle homolog 4 (Drosophila)
naked mole-rat(101710187) prickle homolog 4 (Drosophila)
cow(505030) prickle homolog 4 (Drosophila)
sheep(101109308) prickle homolog 4 (Drosophila)
dog(481795) prickle homolog 4 (Drosophila)
domestic cat(101091622) prickle homolog 4 (Drosophila)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1303180 ANTI-PRIC4 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
SAB3500693 Anti-PRICKLE4 antibody produced in rabbit affinity isolated antibody human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013397 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013397 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013397 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_355019 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355019 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355019 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013397 Rosetta Predictions human pricing
XM_001064610 Rosetta Predictions rat pricing
XM_236920 Rosetta Predictions rat pricing
XM_355019 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013397 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157611 predicted 1201
2 SASI_Hs01_00157612 predicted 582
3 SASI_Hs01_00157613 predicted 823
4 SASI_Hs01_00157614 predicted 1839
5 SASI_Hs01_00157615 predicted 819
6 SASI_Hs01_00157616 predicted 1211
7 SASI_Hs01_00157617 predicted 1516
8 SASI_Hs01_00157618 predicted 1356
9 SASI_Hs02_00344766 predicted 1878
10 SASI_Hs01_00157619 predicted 884
11 SASI_Hs01_00157620 predicted 1374
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00311191 predicted 570
2 SASI_Rn02_00311192 predicted 964
3 SASI_Rn02_00311193 predicted 339
4 SASI_Rn02_00311194 predicted 897
5 SASI_Rn02_00311195 predicted 582
6 SASI_Rn02_00311196 predicted 263
7 SASI_Rn02_00311197 predicted 490
8 SASI_Rn02_00311198 predicted 486
9 SASI_Rn02_00311199 predicted 348
10 SASI_Rn02_00311200 predicted 263
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236920 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390494 predicted 208
2 SASI_Rn02_00390495 predicted 238
3 SASI_Rn02_00390496 predicted 239
4 SASI_Rn02_00390497 predicted 252
5 SASI_Rn02_00390498 predicted 244
6 SASI_Rn02_00390499 predicted 269
7 SASI_Rn02_00390500 predicted 247
8 SASI_Rn02_00390501 predicted 263
9 SASI_Rn02_00390502 predicted 218
10 SASI_Rn02_00390503 predicted 75
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_355019 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425788 predicted 328
2 SASI_Mm02_00425789 predicted 351
3 SASI_Mm02_00425790 predicted 567
4 SASI_Mm02_00425791 predicted 512
5 SASI_Mm02_00425792 predicted 480
6 SASI_Mm02_00425793 predicted 518
7 SASI_Mm02_00425794 predicted 519
8 SASI_Mm02_00425795 predicted 261
9 SASI_Mm02_00425796 predicted 547
10 SASI_Mm02_00425797 predicted 260
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013397
PRICKLE4 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 4 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-1363s21c1
Sequence:CCGGAGGACAGCAACGCCTCTAAGACTCGAGTCTTAGAGGCGTTGCTGTCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013397.5-1556s21c1
Sequence:CCGGTTCAGTACTGCGCGTTCTAAGCTCGAGCTTAGAACGCGCAGTACTGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-1221s21c1
Sequence:CCGGCAATGCCGCCTGGAGACTATTCTCGAGAATAGTCTCCAGGCGGCATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-819s21c1
Sequence:CCGGGCTTGTGACCAGCTGATCTTCCTCGAGGAAGATCAGCTGGTCACAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013397.3-1988s1c1
Sequence:CCGGCGGCTAATGAAACTCCCGAAACTCGAGTTTCGGGAGTTTCATTAGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-710s1c1
Sequence:CCGGCCTGATAAACCTCATCTACTTCTCGAGAAGTAGATGAGGTTTATCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-1266s1c1
Sequence:CCGGGACTCGGAACCTGAAGGATTTCTCGAGAAATCCTTCAGGTTCCGAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-581s1c1
Sequence:CCGGTGAAGGACACACCTGTGAGAACTCGAGTTCTCACAGGTGTGTCCTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-1029s1c1
Sequence:CCGGCGAACTGAAGGAAGGGACCAACTCGAGTTGGTCCCTTCCTTCAGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013397
PRICKLE4 MISSION shRNA shRNA Plasmid DNA
prickle homolog 4 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-1363s21c1
Sequence:CCGGAGGACAGCAACGCCTCTAAGACTCGAGTCTTAGAGGCGTTGCTGTCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013397.5-1556s21c1
Sequence:CCGGTTCAGTACTGCGCGTTCTAAGCTCGAGCTTAGAACGCGCAGTACTGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000418275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-1221s21c1
Sequence:CCGGCAATGCCGCCTGGAGACTATTCTCGAGAATAGTCTCCAGGCGGCATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-819s21c1
Sequence:CCGGGCTTGTGACCAGCTGATCTTCCTCGAGGAAGATCAGCTGGTCACAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013397.3-1988s1c1
Sequence:CCGGCGGCTAATGAAACTCCCGAAACTCGAGTTTCGGGAGTTTCATTAGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-710s1c1
Sequence:CCGGCCTGATAAACCTCATCTACTTCTCGAGAAGTAGATGAGGTTTATCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-1266s1c1
Sequence:CCGGGACTCGGAACCTGAAGGATTTCTCGAGAAATCCTTCAGGTTCCGAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-581s1c1
Sequence:CCGGTGAAGGACACACCTGTGAGAACTCGAGTTCTCACAGGTGTGTCCTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000116356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-1029s1c1
Sequence:CCGGCGAACTGAAGGAAGGGACCAACTCGAGTTGGTCCCTTCCTTCAGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013397
PRICKLE4 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 4 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431132    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-1363s21c1
Sequence:CCGGAGGACAGCAACGCCTCTAAGACTCGAGTCTTAGAGGCGTTGCTGTCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013397.5-1556s21c1
Sequence:CCGGTTCAGTACTGCGCGTTCTAAGCTCGAGCTTAGAACGCGCAGTACTGAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000418275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-1221s21c1
Sequence:CCGGCAATGCCGCCTGGAGACTATTCTCGAGAATAGTCTCCAGGCGGCATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423072    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013397.5-819s21c1
Sequence:CCGGGCTTGTGACCAGCTGATCTTCCTCGAGGAAGATCAGCTGGTCACAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116352    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013397.3-1988s1c1
Sequence:CCGGCGGCTAATGAAACTCCCGAAACTCGAGTTTCGGGAGTTTCATTAGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-710s1c1
Sequence:CCGGCCTGATAAACCTCATCTACTTCTCGAGAAGTAGATGAGGTTTATCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116354    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-1266s1c1
Sequence:CCGGGACTCGGAACCTGAAGGATTTCTCGAGAAATCCTTCAGGTTCCGAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-581s1c1
Sequence:CCGGTGAAGGACACACCTGTGAGAACTCGAGTTCTCACAGGTGTGTCCTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000116356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013397.3-1029s1c1
Sequence:CCGGCGAACTGAAGGAAGGGACCAACTCGAGTTGGTCCCTTCCTTCAGTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355019
PRICKLE4 MISSION shRNA Bacterial Glycerol Stock
prickle homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-489s1c1
Sequence:CCGGCCTCATAAACCTCATCTACTTCTCGAGAAGTAGATGAGGTTTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-548s1c1
Sequence:CCGGCGGAGCTCTTACGACCTCGATCTCGAGATCGAGGTCGTAAGAGCTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-356s1c1
Sequence:CCGGAGCTTGAAGGATACACCTGTACTCGAGTACAGGTGTATCCTTCAAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-244s1c1
Sequence:CCGGGAACGCTACTGTCTGGCCCTACTCGAGTAGGGCCAGACAGTAGCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-167s1c1
Sequence:CCGGGCCTGGATATCAACCAAGTTTCTCGAGAAACTTGGTTGATATCCAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355019
PRICKLE4 MISSION shRNA shRNA Plasmid DNA
prickle homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-489s1c1
Sequence:CCGGCCTCATAAACCTCATCTACTTCTCGAGAAGTAGATGAGGTTTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-548s1c1
Sequence:CCGGCGGAGCTCTTACGACCTCGATCTCGAGATCGAGGTCGTAAGAGCTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-356s1c1
Sequence:CCGGAGCTTGAAGGATACACCTGTACTCGAGTACAGGTGTATCCTTCAAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-244s1c1
Sequence:CCGGGAACGCTACTGTCTGGCCCTACTCGAGTAGGGCCAGACAGTAGCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000091089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-167s1c1
Sequence:CCGGGCCTGGATATCAACCAAGTTTCTCGAGAAACTTGGTTGATATCCAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355019
PRICKLE4 MISSION shRNA Lentiviral Transduction Particles
prickle homolog 4 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-489s1c1
Sequence:CCGGCCTCATAAACCTCATCTACTTCTCGAGAAGTAGATGAGGTTTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-548s1c1
Sequence:CCGGCGGAGCTCTTACGACCTCGATCTCGAGATCGAGGTCGTAAGAGCTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-356s1c1
Sequence:CCGGAGCTTGAAGGATACACCTGTACTCGAGTACAGGTGTATCCTTCAAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-244s1c1
Sequence:CCGGGAACGCTACTGTCTGGCCCTACTCGAGTAGGGCCAGACAGTAGCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000091089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355019.2-167s1c1
Sequence:CCGGGCCTGGATATCAACCAAGTTTCTCGAGAAACTTGGTTGATATCCAGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)