EMAIL THIS PAGE TO A FRIEND

PRIM1

primase, DNA, polypeptide 1 (49kDa)

65 Gene Product Result for
Synonyms: p49
UniProtKB ID: P49642
Gene ID:
Human(5557) Summary: The replication of DNA in eukaryotic cells is carried out by a complex chromosomal replication apparatus, in which DNA polymerase alpha and primase are two key enzymatic components. Primase, which is a heterodimer of a small subunit and a large subunit, synthesizes small RNA primers for the Okazaki fragments made during discontinuous DNA replication. The protein encoded by this gene is the small, 49 kDa primase subunit. [provided by RefSeq, Jul 2008]
Mouse(19075) DNA primase, p49 subunit
Rat(246327) primase, DNA, polypeptide 1
cow(506240) primase, DNA, polypeptide 1 (49kDa)
sheep(101105645) primase, DNA, polypeptide 1 (49kDa)
naked mole-rat(101700362) primase, DNA, polypeptide 1 (49kDa)
Domestic Rabbit(100338944) primase, DNA, polypeptide 1 (49kDa)
domestic guinea pig(100730388) primase, DNA, polypeptide 1 (49kDa)
Zebrafish(30440) primase polypeptide 1
chicken(426646) primase, DNA, polypeptide 1 (49kDa)
Horse(100146777) primase, DNA, polypeptide 1 (49kDa)
domestic cat(101080554) primase, DNA, polypeptide 1 (49kDa)
dog(607309) primase, DNA, polypeptide 1 (49kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008921 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008921 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008921 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000946 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000946 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000946 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU105881 MISSION® esiRNA targeting human PRIM1 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000946 Rosetta Predictions human pricing
NM_001008768 Rosetta Predictions rat pricing
NM_008921 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00209556 predicted 768
2 SASI_Hs01_00209557 predicted 998
3 SASI_Hs01_00209558 predicted 1179
4 SASI_Hs02_00303555 predicted 201
5 SASI_Hs01_00209559 predicted 480
6 SASI_Hs01_00209561 predicted 894
7 SASI_Hs01_00209563 predicted 1089
8 SASI_Hs01_00209564 predicted 416
9 SASI_Hs02_00303556 predicted 1054
10 SASI_Hs02_00303557 predicted 583
11 SASI_Hs01_00209560 predicted 632
12 SASI_Hs01_00209562 predicted 746
13 SASI_Hs01_00209565 predicted 1089
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008768 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199278 predicted 991
2 SASI_Rn02_00199279 predicted 934
3 SASI_Rn02_00199280 predicted 690
4 SASI_Rn02_00199281 predicted 943
5 SASI_Rn02_00199282 predicted 671
6 SASI_Rn02_00199283 predicted 1042
7 SASI_Rn02_00199284 predicted 933
8 SASI_Rn02_00199285 predicted 515
9 SASI_Rn02_00199286 predicted 845
10 SASI_Rn02_00199287 predicted 1029
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008921 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00052153 predicted 1256
2 SASI_Mm01_00052154 predicted 307
3 SASI_Mm01_00052155 predicted 265
4 SASI_Mm01_00052156 predicted 705
5 SASI_Mm01_00052157 predicted 1043
6 SASI_Mm01_00052158 predicted 865
7 SASI_Mm01_00052159 predicted 537
8 SASI_Mm01_00052160 predicted 401
9 SASI_Mm01_00052161 predicted 366
10 SASI_Mm01_00052162 predicted 1052
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008921
VALIDATED
PRIM1 MISSION shRNA Bacterial Glycerol Stock
primase, DNA, polypeptide 1 (49kDa)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1374s1c1
Sequence:CCGGGCCTCAATCCTTGAAGCAGAACTCGAGTTCTGCTTCAAGGATTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1092s1c1
Sequence:CCGGGCCGGGAATTGGATATGGTTTCTCGAGAAACCATATCCAATTCCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008921.1-1047s1c1
Sequence:CCGGTGGATCAATTTGATCCGTTTACTCGAGTAAACGGATCAAATTGATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-62s1c1
Sequence:CCGGCCGGAGCTACTCAAGCTTTATCTCGAGATAAAGCTTGAGTAGCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000119953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1190s1c1
Sequence:CCGGGCACCGTATGTGAAAGTATTTCTCGAGAAATACTTTCACATACGGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008921
VALIDATED
PRIM1 MISSION shRNA shRNA Plasmid DNA
primase, DNA, polypeptide 1 (49kDa)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1374s1c1
Sequence:CCGGGCCTCAATCCTTGAAGCAGAACTCGAGTTCTGCTTCAAGGATTGAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000119954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1092s1c1
Sequence:CCGGGCCGGGAATTGGATATGGTTTCTCGAGAAACCATATCCAATTCCCGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000119956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008921.1-1047s1c1
Sequence:CCGGTGGATCAATTTGATCCGTTTACTCGAGTAAACGGATCAAATTGATCCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000119955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-62s1c1
Sequence:CCGGCCGGAGCTACTCAAGCTTTATCTCGAGATAAAGCTTGAGTAGCTCCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000119953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1190s1c1
Sequence:CCGGGCACCGTATGTGAAAGTATTTCTCGAGAAATACTTTCACATACGGTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008921
VALIDATED
PRIM1 MISSION shRNA Lentiviral Transduction Particles
primase, DNA, polypeptide 1 (49kDa)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119952    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1374s1c1
Sequence:CCGGGCCTCAATCCTTGAAGCAGAACTCGAGTTCTGCTTCAAGGATTGAGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1092s1c1
Sequence:CCGGGCCGGGAATTGGATATGGTTTCTCGAGAAACCATATCCAATTCCCGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008921.1-1047s1c1
Sequence:CCGGTGGATCAATTTGATCCGTTTACTCGAGTAAACGGATCAAATTGATCCATTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-62s1c1
Sequence:CCGGCCGGAGCTACTCAAGCTTTATCTCGAGATAAAGCTTGAGTAGCTCCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000119953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008921.1-1190s1c1
Sequence:CCGGGCACCGTATGTGAAAGTATTTCTCGAGAAATACTTTCACATACGGTGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000946
VALIDATED
PRIM1 MISSION shRNA Bacterial Glycerol Stock
primase, DNA, polypeptide 1 (49kDa)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-797s21c1
Sequence:CCGGGCCCTTGTTCCTGAAACAATTCTCGAGAATTGTTTCAGGAACAAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000179486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-797s1c1
Sequence:CCGGGCCCTTGTTCCTGAAACAATTCTCGAGAATTGTTTCAGGAACAAGGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-1190s21c1
Sequence:CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-522s21c1
Sequence:CCGGAGCATCGTCTCTGGGTATATTCTCGAGAATATACCCAGAGACGATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-93s1c1
Sequence:CCGGCCGAGCTGCTTAAACTTTATTCTCGAGAATAAAGTTTAAGCAGCTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000151196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-1190s1c1
Sequence:CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000182880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-571s1c1
Sequence:CCGGCTGTGATGAATCAGTTAGAAACTCGAGTTTCTAACTGATTCATCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-93s21c1
Sequence:CCGGCCGAGCTGCTTAAACTTTATTCTCGAGAATAAAGTTTAAGCAGCTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000275195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-295s21c1
Sequence:CCGGGATTGATATAGGCGCAGTATACTCGAGTATACTGCGCCTATATCAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000946
VALIDATED
PRIM1 MISSION shRNA shRNA Plasmid DNA
primase, DNA, polypeptide 1 (49kDa)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-797s21c1
Sequence:CCGGGCCCTTGTTCCTGAAACAATTCTCGAGAATTGTTTCAGGAACAAGGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000179486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-797s1c1
Sequence:CCGGGCCCTTGTTCCTGAAACAATTCTCGAGAATTGTTTCAGGAACAAGGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000275192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-1190s21c1
Sequence:CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000275194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-522s21c1
Sequence:CCGGAGCATCGTCTCTGGGTATATTCTCGAGAATATACCCAGAGACGATGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000151860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-93s1c1
Sequence:CCGGCCGAGCTGCTTAAACTTTATTCTCGAGAATAAAGTTTAAGCAGCTCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000151196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-1190s1c1
Sequence:CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000182880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-571s1c1
Sequence:CCGGCTGTGATGAATCAGTTAGAAACTCGAGTTTCTAACTGATTCATCACAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000275196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-93s21c1
Sequence:CCGGCCGAGCTGCTTAAACTTTATTCTCGAGAATAAAGTTTAAGCAGCTCGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000275195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-295s21c1
Sequence:CCGGGATTGATATAGGCGCAGTATACTCGAGTATACTGCGCCTATATCAATCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000946
VALIDATED
PRIM1 MISSION shRNA Lentiviral Transduction Particles
primase, DNA, polypeptide 1 (49kDa)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-797s21c1
Sequence:CCGGGCCCTTGTTCCTGAAACAATTCTCGAGAATTGTTTCAGGAACAAGGGCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000179486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-797s1c1
Sequence:CCGGGCCCTTGTTCCTGAAACAATTCTCGAGAATTGTTTCAGGAACAAGGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-1190s21c1
Sequence:CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-522s21c1
Sequence:CCGGAGCATCGTCTCTGGGTATATTCTCGAGAATATACCCAGAGACGATGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000151860    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-93s1c1
Sequence:CCGGCCGAGCTGCTTAAACTTTATTCTCGAGAATAAAGTTTAAGCAGCTCGGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000151196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-1190s1c1
Sequence:CCGGGTCAAACATAGAACCAGAGATCTCGAGATCTCTGGTTCTATGTTTGACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000182880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000946.2-571s1c1
Sequence:CCGGCTGTGATGAATCAGTTAGAAACTCGAGTTTCTAACTGATTCATCACAGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275196    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-93s21c1
Sequence:CCGGCCGAGCTGCTTAAACTTTATTCTCGAGAATAAAGTTTAAGCAGCTCGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000275195    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_000946.2-295s21c1
Sequence:CCGGGATTGATATAGGCGCAGTATACTCGAGTATACTGCGCCTATATCAATCTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???