EMAIL THIS PAGE TO A FRIEND

PRIM2

primase, DNA, polypeptide 2 (58kDa)

60 Gene Product Result for
Synonyms: PRIM2A p58
UniProtKB ID: P49643, Q53FJ8, Q6P1Q7, Q8WVL2, Q9H413
Gene ID:
Human(5558) Summary: The replication of DNA in eukaryotic cells is carried out by a complex chromosomal replication apparatus, in which DNA polymerase alpha and primase are two key enzymatic components. Primase, which is a heterodimer of a small subunit and a large subunit, synthesizes small RNA primers for the Okazaki fragments made during discontinuous DNA replication. The protein encoded by this gene is the large, 58 kDa primase subunit. [provided by RefSeq, Jul 2008]
Mouse(19076) DNA primase, p58 subunit
Rat(301323) primase, DNA, polypeptide 2
chicken(421878) primase, DNA, polypeptide 2 (58kDa)
dog(474950) primase, DNA, polypeptide 2 (58kDa)
Horse(100056923) primase, DNA, polypeptide 2 (58kDa)
domestic guinea pig(100726716) primase, DNA, polypeptide 2 (58kDa)
cow(514682) primase, DNA, polypeptide 2 (58kDa)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000947 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000947 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000947 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008922 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008922 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008922 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014271 MISSION® esiRNA targeting human PRIM2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000947 Rosetta Predictions human pricing
NM_001024762 Rosetta Predictions rat pricing
NM_008922 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038267 predicted 1083
2 SASI_Hs01_00038268 predicted 219
3 SASI_Hs02_00303558 predicted 222
4 SASI_Hs01_00038269 predicted 889
5 SASI_Hs01_00038270 predicted 882
6 SASI_Hs01_00038271 predicted 890
7 SASI_Hs01_00038272 predicted 269
8 SASI_Hs01_00038273 predicted 1284
9 SASI_Hs01_00038274 predicted 1167
10 SASI_Hs02_00303559 predicted 1442
11 SASI_Hs01_00038266 predicted 1164
12 SASI_Hs01_00038275 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024762 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00090364 predicted 1135
2 SASI_Rn01_00090365 predicted 1609
3 SASI_Rn01_00090366 predicted 1753
4 SASI_Rn01_00090367 predicted 1082
5 SASI_Rn01_00090368 predicted 424
6 SASI_Rn01_00090370 predicted 977
7 SASI_Rn01_00090371 predicted 1299
8 SASI_Rn01_00090372 predicted 1079
9 SASI_Rn02_00202641 predicted 1362
10 SASI_Rn01_00090373 predicted 485
11 SASI_Rn01_00090369 predicted 1661
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178765 predicted 562
2 SASI_Mm01_00178766 predicted 1408
3 SASI_Mm01_00178767 predicted 905
4 SASI_Mm01_00178768 predicted 1501
5 SASI_Mm01_00178769 predicted 669
6 SASI_Mm01_00178770 predicted 816
7 SASI_Mm01_00178771 predicted 572
8 SASI_Mm01_00178772 predicted 935
9 SASI_Mm01_00178773 predicted 789
10 SASI_Mm02_00314954 predicted 328
11 SASI_Mm01_00178774 predicted 907
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000947
VALIDATED
PRIM2 MISSION shRNA Bacterial Glycerol Stock
primase, DNA, polypeptide 2 (58kDa)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-1002s21c1
Sequence:CCGGCCGAATGCAGTATGGCCTATTCTCGAGAATAGGCCATACTGCATTCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-457s21c1
Sequence:CCGGGAAATGGATCTCCTTCGATTTCTCGAGAAATCGAAGGAGATCCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-1061s21c1
Sequence:CCGGAGTTCTGGAAGCAAGAATTTACTCGAGTAAATTCTTGCTTCCAGAACTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-150s1c1
Sequence:CCGGCTACCCTCATTGCCTTCAGTTCTCGAGAACTGAAGGCAATGAGGGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000431981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-764s21c1
Sequence:CCGGTGTCCAAGGCTTTGGCATTAACTCGAGTTAATGCCAAAGCCTTGGACATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000947.x-346s1c1
Sequence:CCGGGAGAAGCTAGAAGATGAATATCTCGAGATATTCATCTTCTAGCTTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-344s1c1
Sequence:CCGGGAGAGAAGCTAGAAGATGAATCTCGAGATTCATCTTCTAGCTTCTCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-710s21c1
Sequence:CCGGACGTACCACTTAAGGACATTGCTCGAGCAATGTCCTTAAGTGGTACGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-2202s1c1
Sequence:CCGGCCCAGAAACTACAATAAAGAACTCGAGTTCTTTATTGTAGTTTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-371s1c1
Sequence:CCGGCACGAAGAAGAGATCATATTTCTCGAGAAATATGATCTCTTCTTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-945s21c1
Sequence:CCGGTTGCATGCGTCAGTTACATAACTCGAGTTATGTAACTGACGCATGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000947
VALIDATED
PRIM2 MISSION shRNA shRNA Plasmid DNA
primase, DNA, polypeptide 2 (58kDa)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-1002s21c1
Sequence:CCGGCCGAATGCAGTATGGCCTATTCTCGAGAATAGGCCATACTGCATTCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000415435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-457s21c1
Sequence:CCGGGAAATGGATCTCCTTCGATTTCTCGAGAAATCGAAGGAGATCCATTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000415928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-1061s21c1
Sequence:CCGGAGTTCTGGAAGCAAGAATTTACTCGAGTAAATTCTTGCTTCCAGAACTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-150s1c1
Sequence:CCGGCTACCCTCATTGCCTTCAGTTCTCGAGAACTGAAGGCAATGAGGGTAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000431981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-764s21c1
Sequence:CCGGTGTCCAAGGCTTTGGCATTAACTCGAGTTAATGCCAAAGCCTTGGACATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000947.x-346s1c1
Sequence:CCGGGAGAAGCTAGAAGATGAATATCTCGAGATATTCATCTTCTAGCTTCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-344s1c1
Sequence:CCGGGAGAGAAGCTAGAAGATGAATCTCGAGATTCATCTTCTAGCTTCTCTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000420795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-710s21c1
Sequence:CCGGACGTACCACTTAAGGACATTGCTCGAGCAATGTCCTTAAGTGGTACGTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-2202s1c1
Sequence:CCGGCCCAGAAACTACAATAAAGAACTCGAGTTCTTTATTGTAGTTTCTGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-371s1c1
Sequence:CCGGCACGAAGAAGAGATCATATTTCTCGAGAAATATGATCTCTTCTTCGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000428211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-945s21c1
Sequence:CCGGTTGCATGCGTCAGTTACATAACTCGAGTTATGTAACTGACGCATGCAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000947
VALIDATED
PRIM2 MISSION shRNA Lentiviral Transduction Particles
primase, DNA, polypeptide 2 (58kDa)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-1002s21c1
Sequence:CCGGCCGAATGCAGTATGGCCTATTCTCGAGAATAGGCCATACTGCATTCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-457s21c1
Sequence:CCGGGAAATGGATCTCCTTCGATTTCTCGAGAAATCGAAGGAGATCCATTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-1061s21c1
Sequence:CCGGAGTTCTGGAAGCAAGAATTTACTCGAGTAAATTCTTGCTTCCAGAACTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-150s1c1
Sequence:CCGGCTACCCTCATTGCCTTCAGTTCTCGAGAACTGAAGGCAATGAGGGTAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000431981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-764s21c1
Sequence:CCGGTGTCCAAGGCTTTGGCATTAACTCGAGTTAATGCCAAAGCCTTGGACATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000947.x-346s1c1
Sequence:CCGGGAGAAGCTAGAAGATGAATATCTCGAGATATTCATCTTCTAGCTTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-344s1c1
Sequence:CCGGGAGAGAAGCTAGAAGATGAATCTCGAGATTCATCTTCTAGCTTCTCTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-710s21c1
Sequence:CCGGACGTACCACTTAAGGACATTGCTCGAGCAATGTCCTTAAGTGGTACGTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-2202s1c1
Sequence:CCGGCCCAGAAACTACAATAAAGAACTCGAGTTCTTTATTGTAGTTTCTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000947.x-371s1c1
Sequence:CCGGCACGAAGAAGAGATCATATTTCTCGAGAAATATGATCTCTTCTTCGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000947.2-945s21c1
Sequence:CCGGTTGCATGCGTCAGTTACATAACTCGAGTTATGTAACTGACGCATGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008922
VALIDATED
PRIM2 MISSION shRNA Bacterial Glycerol Stock
primase, DNA, polypeptide 2 (58kDa)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1233s21c1
Sequence:CCGGGCCTTTCAGTTGCATGAAGATCTCGAGATCTTCATGCAACTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1153s21c1
Sequence:CCGGGACCCAGACAAGTTTGATAAACTCGAGTTTATCAAACTTGTCTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008922.1-1711s21c1
Sequence:CCGGCCTGTTTGAAAGGTTTACAAACTCGAGTTTGTAAACCTTTCAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1128s21c1
Sequence:CCGGGCAGGAGTTTATCAGAGGAAACTCGAGTTTCCTCTGATAAACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000326546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-790s21c1
Sequence:CCGGGCCATTATCTTGAACGAGTTTCTCGAGAAACTCGTTCAAGATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1711s1c1
Sequence:CCGGCCTGTTTGAAAGGTTTACAAACTCGAGTTTGTAAACCTTTCAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-790s1c1
Sequence:CCGGGCCATTATCTTGAACGAGTTTCTCGAGAAACTCGTTCAAGATAATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1153s1c1
Sequence:CCGGGACCCAGACAAGTTTGATAAACTCGAGTTTATCAAACTTGTCTGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1128s1c1
Sequence:CCGGGCAGGAGTTTATCAGAGGAAACTCGAGTTTCCTCTGATAAACTCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000111468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1233s1c1
Sequence:CCGGGCCTTTCAGTTGCATGAAGATCTCGAGATCTTCATGCAACTGAAAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008922
VALIDATED
PRIM2 MISSION shRNA shRNA Plasmid DNA
primase, DNA, polypeptide 2 (58kDa)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1233s21c1
Sequence:CCGGGCCTTTCAGTTGCATGAAGATCTCGAGATCTTCATGCAACTGAAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1153s21c1
Sequence:CCGGGACCCAGACAAGTTTGATAAACTCGAGTTTATCAAACTTGTCTGGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008922.1-1711s21c1
Sequence:CCGGCCTGTTTGAAAGGTTTACAAACTCGAGTTTGTAAACCTTTCAAACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1128s21c1
Sequence:CCGGGCAGGAGTTTATCAGAGGAAACTCGAGTTTCCTCTGATAAACTCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000326546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-790s21c1
Sequence:CCGGGCCATTATCTTGAACGAGTTTCTCGAGAAACTCGTTCAAGATAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000111465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1711s1c1
Sequence:CCGGCCTGTTTGAAAGGTTTACAAACTCGAGTTTGTAAACCTTTCAAACAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000111466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-790s1c1
Sequence:CCGGGCCATTATCTTGAACGAGTTTCTCGAGAAACTCGTTCAAGATAATGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000111469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1153s1c1
Sequence:CCGGGACCCAGACAAGTTTGATAAACTCGAGTTTATCAAACTTGTCTGGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000111467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1128s1c1
Sequence:CCGGGCAGGAGTTTATCAGAGGAAACTCGAGTTTCCTCTGATAAACTCCTGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000111468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1233s1c1
Sequence:CCGGGCCTTTCAGTTGCATGAAGATCTCGAGATCTTCATGCAACTGAAAGGCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008922
VALIDATED
PRIM2 MISSION shRNA Lentiviral Transduction Particles
primase, DNA, polypeptide 2 (58kDa)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1233s21c1
Sequence:CCGGGCCTTTCAGTTGCATGAAGATCTCGAGATCTTCATGCAACTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1153s21c1
Sequence:CCGGGACCCAGACAAGTTTGATAAACTCGAGTTTATCAAACTTGTCTGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326613    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008922.1-1711s21c1
Sequence:CCGGCCTGTTTGAAAGGTTTACAAACTCGAGTTTGTAAACCTTTCAAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-1128s21c1
Sequence:CCGGGCAGGAGTTTATCAGAGGAAACTCGAGTTTCCTCTGATAAACTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000326546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008922.1-790s21c1
Sequence:CCGGGCCATTATCTTGAACGAGTTTCTCGAGAAACTCGTTCAAGATAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111465    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1711s1c1
Sequence:CCGGCCTGTTTGAAAGGTTTACAAACTCGAGTTTGTAAACCTTTCAAACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-790s1c1
Sequence:CCGGGCCATTATCTTGAACGAGTTTCTCGAGAAACTCGTTCAAGATAATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1153s1c1
Sequence:CCGGGACCCAGACAAGTTTGATAAACTCGAGTTTATCAAACTTGTCTGGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1128s1c1
Sequence:CCGGGCAGGAGTTTATCAGAGGAAACTCGAGTTTCCTCTGATAAACTCCTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000111468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008922.1-1233s1c1
Sequence:CCGGGCCTTTCAGTTGCATGAAGATCTCGAGATCTTCATGCAACTGAAAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)