EMAIL THIS PAGE TO A FRIEND

PRKAB1

protein kinase, AMP-activated, beta 1 non-catalytic subunit

80 Gene Product Result for
Synonyms: AMPK HAMPKb
UniProtKB ID: Q9Y478, Q9UBV0, Q9UE20, Q9UEX2, Q9Y6V8
Gene ID:
Human(5564) Summary: The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. The myristoylation and phosphorylation of this subunit have been shown to affect the enzyme activity and cellular localization of AMPK. This subunit may also serve as an adaptor molecule mediating the association of the AMPK complex. [provided by RefSeq, Jul 2008]
Mouse(19079) protein kinase, AMP-activated, beta 1 non-catalytic subunit
Rat(83803) protein kinase, AMP-activated, beta 1 non-catalytic subunit
chicken(416986) protein kinase, AMP-activated, beta 1 non-catalytic subunit
Horse(100034094) protein kinase, AMP-activated, beta 1 non-catalytic subunit
domestic cat(101094051) protein kinase, AMP-activated, beta 1 non-catalytic subunit
dog(486295) protein kinase, AMP-activated, beta 1 non-catalytic subunit
naked mole-rat(101705863) protein kinase, AMP-activated, beta 1 non-catalytic subunit
domestic guinea pig(100719458) protein kinase, AMP-activated, beta 1 non-catalytic subunit
cow(534107) protein kinase, AMP-activated, beta 1 non-catalytic subunit
sheep(101107899) protein kinase, AMP-activated, beta 1 non-catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006253 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006253 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006253 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_031869 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031869 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031869 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU035991 MISSION® esiRNA esiRNA human PRKAB1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006253 Rosetta Predictions human pricing
NM_031976 Rosetta Predictions rat pricing
NM_031869 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006253 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00098667 predicted 777
2 SASI_Hs01_00098669 predicted 1180
3 SASI_Hs01_00098670 predicted 1176
4 SASI_Hs01_00098671 predicted 996
5 SASI_Hs01_00098672 predicted 1322
6 SASI_Hs02_00341191 predicted 729
7 SASI_Hs01_00098674 predicted 1075
8 SASI_Hs01_00098675 predicted 756
9 SASI_Hs01_00098676 predicted 478
10 SASI_Hs02_00341192 predicted 609
11 SASI_Hs01_00098668 predicted 441
12 SASI_Hs01_00098673 predicted 735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031976 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049536 predicted 692
2 SASI_Rn02_00265370 predicted 811
3 SASI_Rn01_00049537 predicted 919
4 SASI_Rn02_00265371 predicted 988
5 SASI_Rn01_00049539 predicted 681
6 SASI_Rn01_00049540 predicted 249
7 SASI_Rn01_00049541 predicted 903
8 SASI_Rn01_00049543 predicted 841
9 SASI_Rn01_00049544 predicted 1032
10 SASI_Rn02_00265372 predicted 1006
11 SASI_Rn01_00049538 predicted 753
12 SASI_Rn01_00049542 predicted 838
13 SASI_Rn01_00049545 predicted 1251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031869 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00090539 predicted 1260
2 SASI_Mm01_00090540 predicted 579
3 SASI_Mm01_00090541 predicted 575
4 SASI_Mm01_00090542 predicted 1382
5 SASI_Mm01_00090543 predicted 320
6 SASI_Mm02_00337183 predicted 612
7 SASI_Mm01_00090544 predicted 620
8 SASI_Mm01_00090545 predicted 498
9 SASI_Mm01_00090546 predicted 981
10 SASI_Mm01_00090547 predicted 890
11 SASI_Mm01_00090548 predicted 1420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006253
VALIDATED
PRKAB1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, beta 1 non-catalytic subunit
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000356255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-1068s21c1
Sequence:CCGGAGTACGTCACCACCTTGTTATCTCGAGATAACAAGGTGGTGACGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-989s21c1
Sequence:CCGGGTCATGCTGAACCACCTATACCTCGAGGTATAGGTGGTTCAGCATGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_006253.4-1555s1c1
Sequence:CCGGGCCTGGCTATGGAACTAAATACTCGAGTATTTAGTTCCATAGCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-601s1c1
Sequence:CCGGCCTCACCAGAAGCCACAATAACTCGAGTTATTGTGGCTTCTGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-1012s1c1
Sequence:CCGGGCTGTCTATCAAGGATGGAGTCTCGAGACTCCATCCTTGATAGACAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-1411s21c1
Sequence:CCGGCTAAACCTACATTCTCGATTTCTCGAGAAATCGAGAATGTAGGTTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-479s1c1
Sequence:CCGGCAGCATGATCTGGAAGTGAATCTCGAGATTCACTTCCAGATCATGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006253.4-1452s1c1
Sequence:CCGGGCTAACTCCTTTGCCAGTAAACTCGAGTTTACTGGCAAAGGAGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-424s1c1
Sequence:CCGGCCTCTTCCACTCCGAGGAAATCTCGAGATTTCCTCGGAGTGGAAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-1072s1c1
Sequence:CCGGCGTCACCACCTTGTTATACAACTCGAGTTGTATAACAAGGTGGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006253
VALIDATED
PRKAB1 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, beta 1 non-catalytic subunit
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000356255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-1068s21c1
Sequence:CCGGAGTACGTCACCACCTTGTTATCTCGAGATAACAAGGTGGTGACGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-989s21c1
Sequence:CCGGGTCATGCTGAACCACCTATACCTCGAGGTATAGGTGGTTCAGCATGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_006253.4-1555s1c1
Sequence:CCGGGCCTGGCTATGGAACTAAATACTCGAGTATTTAGTTCCATAGCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-601s1c1
Sequence:CCGGCCTCACCAGAAGCCACAATAACTCGAGTTATTGTGGCTTCTGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-1012s1c1
Sequence:CCGGGCTGTCTATCAAGGATGGAGTCTCGAGACTCCATCCTTGATAGACAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-1411s21c1
Sequence:CCGGCTAAACCTACATTCTCGATTTCTCGAGAAATCGAGAATGTAGGTTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-479s1c1
Sequence:CCGGCAGCATGATCTGGAAGTGAATCTCGAGATTCACTTCCAGATCATGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006253.4-1452s1c1
Sequence:CCGGGCTAACTCCTTTGCCAGTAAACTCGAGTTTACTGGCAAAGGAGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000200000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-424s1c1
Sequence:CCGGCCTCTTCCACTCCGAGGAAATCTCGAGATTTCCTCGGAGTGGAAGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000004772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-1072s1c1
Sequence:CCGGCGTCACCACCTTGTTATACAACTCGAGTTGTATAACAAGGTGGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006253
VALIDATED
PRKAB1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, beta 1 non-catalytic subunit
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000356255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-1068s21c1
Sequence:CCGGAGTACGTCACCACCTTGTTATCTCGAGATAACAAGGTGGTGACGTACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-989s21c1
Sequence:CCGGGTCATGCTGAACCACCTATACCTCGAGGTATAGGTGGTTCAGCATGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004770    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_006253.4-1555s1c1
Sequence:CCGGGCCTGGCTATGGAACTAAATACTCGAGTATTTAGTTCCATAGCCAGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-601s1c1
Sequence:CCGGCCTCACCAGAAGCCACAATAACTCGAGTTATTGTGGCTTCTGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-1012s1c1
Sequence:CCGGGCTGTCTATCAAGGATGGAGTCTCGAGACTCCATCCTTGATAGACAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356266    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_006253.4-1411s21c1
Sequence:CCGGCTAAACCTACATTCTCGATTTCTCGAGAAATCGAGAATGTAGGTTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-479s1c1
Sequence:CCGGCAGCATGATCTGGAAGTGAATCTCGAGATTCACTTCCAGATCATGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197220    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006253.4-1452s1c1
Sequence:CCGGGCTAACTCCTTTGCCAGTAAACTCGAGTTTACTGGCAAAGGAGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000200000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-424s1c1
Sequence:CCGGCCTCTTCCACTCCGAGGAAATCTCGAGATTTCCTCGGAGTGGAAGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000004772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006253.4-1072s1c1
Sequence:CCGGCGTCACCACCTTGTTATACAACTCGAGTTGTATAACAAGGTGGTGACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031869
VALIDATED
PRKAB1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, beta 1 non-catalytic subunit
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-608s21c1
Sequence:CCGGCAGCCAGCTTGGCACAGTTAACTCGAGTTAACTGTGCCAAGCTGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-970s21c1
Sequence:CCGGCCCTCCTCTACAAGCCGATATCTCGAGATATCGGCTTGTAGAGGAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-309s21c1
Sequence:CCGGGCCGACATCTTCCACTCCGAACTCGAGTTCGGAGTGGAAGATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031869.2-1484s21c1
Sequence:CCGGCACTCCTACGTAAGGCAATAACTCGAGTTATTGCCTTACGTAGGAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031869.2-581s21c1
Sequence:CCGGCCATGATCCTTCTGAGCCAATCTCGAGATTGGCTCAGAAGGATCATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-503s1c1
Sequence:CCGGCCAGAATAACTTTGTAGCCATCTCGAGATGGCTACAAAGTTATTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-374s1c1
Sequence:CCGGCGACCTGGAAGCGAATGATAACTCGAGTTATCATTCGCTTCCAGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-581s1c1
Sequence:CCGGCCATGATCCTTCTGAGCCAATCTCGAGATTGGCTCAGAAGGATCATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-309s1c1
Sequence:CCGGGCCGACATCTTCCACTCCGAACTCGAGTTCGGAGTGGAAGATGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-970s1c1
Sequence:CCGGCCCTCCTCTACAAGCCGATATCTCGAGATATCGGCTTGTAGAGGAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031869
VALIDATED
PRKAB1 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, beta 1 non-catalytic subunit
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-608s21c1
Sequence:CCGGCAGCCAGCTTGGCACAGTTAACTCGAGTTAACTGTGCCAAGCTGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-970s21c1
Sequence:CCGGCCCTCCTCTACAAGCCGATATCTCGAGATATCGGCTTGTAGAGGAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-309s21c1
Sequence:CCGGGCCGACATCTTCCACTCCGAACTCGAGTTCGGAGTGGAAGATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031869.2-1484s21c1
Sequence:CCGGCACTCCTACGTAAGGCAATAACTCGAGTTATTGCCTTACGTAGGAGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031869.2-581s21c1
Sequence:CCGGCCATGATCCTTCTGAGCCAATCTCGAGATTGGCTCAGAAGGATCATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-503s1c1
Sequence:CCGGCCAGAATAACTTTGTAGCCATCTCGAGATGGCTACAAAGTTATTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-374s1c1
Sequence:CCGGCGACCTGGAAGCGAATGATAACTCGAGTTATCATTCGCTTCCAGGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-581s1c1
Sequence:CCGGCCATGATCCTTCTGAGCCAATCTCGAGATTGGCTCAGAAGGATCATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-309s1c1
Sequence:CCGGGCCGACATCTTCCACTCCGAACTCGAGTTCGGAGTGGAAGATGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-970s1c1
Sequence:CCGGCCCTCCTCTACAAGCCGATATCTCGAGATATCGGCTTGTAGAGGAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031869
VALIDATED
PRKAB1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, beta 1 non-catalytic subunit
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-608s21c1
Sequence:CCGGCAGCCAGCTTGGCACAGTTAACTCGAGTTAACTGTGCCAAGCTGGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-970s21c1
Sequence:CCGGCCCTCCTCTACAAGCCGATATCTCGAGATATCGGCTTGTAGAGGAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031869.2-309s21c1
Sequence:CCGGGCCGACATCTTCCACTCCGAACTCGAGTTCGGAGTGGAAGATGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031869.2-1484s21c1
Sequence:CCGGCACTCCTACGTAAGGCAATAACTCGAGTTATTGCCTTACGTAGGAGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274638    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_031869.2-581s21c1
Sequence:CCGGCCATGATCCTTCTGAGCCAATCTCGAGATTGGCTCAGAAGGATCATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025104    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-503s1c1
Sequence:CCGGCCAGAATAACTTTGTAGCCATCTCGAGATGGCTACAAAGTTATTCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-374s1c1
Sequence:CCGGCGACCTGGAAGCGAATGATAACTCGAGTTATCATTCGCTTCCAGGTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025105    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-581s1c1
Sequence:CCGGCCATGATCCTTCTGAGCCAATCTCGAGATTGGCTCAGAAGGATCATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-309s1c1
Sequence:CCGGGCCGACATCTTCCACTCCGAACTCGAGTTCGGAGTGGAAGATGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025108    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_031869.1-970s1c1
Sequence:CCGGCCCTCCTCTACAAGCCGATATCTCGAGATATCGGCTTGTAGAGGAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)