EMAIL THIS PAGE TO A FRIEND

PRKAB2

protein kinase, AMP-activated, beta 2 non-catalytic subunit

289 Gene Product Result for
UniProtKB ID: O43741, A8K9V5, Q5VXY0
Gene ID:
Human(5565) Summary: The protein encoded by this gene is a regulatory subunit of the AMP-activated protein kinase (AMPK). AMPK is a heterotrimer consisting of an alpha catalytic subunit, and non-catalytic beta and gamma subunits. AMPK is an important energy-sensing enzyme that monitors cellular energy status. In response to cellular metabolic stresses, AMPK is activated, and thus phosphorylates and inactivates acetyl-CoA carboxylase (ACC) and beta-hydroxy beta-methylglutaryl-CoA reductase (HMGCR), key enzymes involved in regulating de novo biosynthesis of fatty acid and cholesterol. This subunit may be a positive regulator of AMPK activity. It is highly expressed in skeletal muscle and thus may have tissue-specific roles. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2013]
Mouse(108097) protein kinase, AMP-activated, beta 2 non-catalytic subunit
Rat(64562) protein kinase, AMP-activated, beta 2 non-catalytic subunit
Zebrafish(100170795) protein kinase, AMP-activated, beta 2 non-catalytic subunit
Horse(100034095) protein kinase, AMP-activated, beta 2 non-catalytic subunit
domestic cat(101092284) protein kinase, AMP-activated, beta 2 non-catalytic subunit
dog(612807) protein kinase, AMP-activated, beta 2 non-catalytic subunit
chicken(427017) protein kinase, AMP-activated, beta 2 non-catalytic subunit
cow(512665) protein kinase, AMP-activated, beta 2 non-catalytic subunit
sheep(101113114) protein kinase, AMP-activated, beta 2 non-catalytic subunit
domestic guinea pig(100728100) protein kinase, AMP-activated, beta 2 non-catalytic subunit
naked mole-rat(101720100) protein kinase, AMP-activated, beta 2 non-catalytic subunit
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005399 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_182997 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_182997 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_182997 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005399 Rosetta Predictions human pricing
NM_022627 Rosetta Predictions rat pricing
NM_182997 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071303 predicted 627
2 SASI_Hs01_00071304 predicted 336
3 SASI_Hs01_00071305 predicted 928
4 SASI_Hs01_00071306 predicted 712
5 SASI_Hs01_00071307 predicted 861
6 SASI_Hs01_00071308 predicted 630
7 SASI_Hs01_00071309 predicted 862
8 SASI_Hs01_00071310 predicted 650
9 SASI_Hs01_00071311 predicted 770
10 SASI_Hs01_00071312 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263413 predicted 480
2 SASI_Rn01_00043167 predicted 298
3 SASI_Rn01_00043168 predicted 309
4 SASI_Rn01_00043169 predicted 688
5 SASI_Rn01_00043170 predicted 1030
6 SASI_Rn01_00043171 predicted 460
7 SASI_Rn01_00043172 predicted 572
8 SASI_Rn02_00263414 predicted 801
9 SASI_Rn01_00043173 predicted 559
10 SASI_Rn01_00043174 predicted 324
11 SASI_Rn01_00043175 predicted 965
12 SASI_Rn01_00043176 predicted 726
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182997 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162220 predicted 477
2 SASI_Mm01_00162221 predicted 860
3 SASI_Mm02_00350005 predicted 1213
4 SASI_Mm01_00162223 predicted 1169
5 SASI_Mm01_00162224 predicted 482
6 SASI_Mm02_00350006 predicted 740
7 SASI_Mm01_00162226 predicted 614
8 SASI_Mm01_00162227 predicted 412
9 SASI_Mm01_00162228 predicted 897
10 SASI_Mm01_00162229 predicted 1213
11 SASI_Mm01_00162222 predicted 752
12 SASI_Mm01_00162225 predicted 503
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005399
VALIDATED
PRKAB2 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, beta 2 non-catalytic subunit
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-579s21c1
Sequence:GTACCGGAGCTTGGCACAATTAACAATTCTCGAGAATTGTTAATTGTGCCAAGCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-337s21c1
Sequence:GTACCGGGGATTTGGAGGACTCCGTAAACTCGAGTTTACGGAGTCCTCCAAATCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-943s21c1
Sequence:CCGGTCTGCTATACAAGCCCATTTGCTCGAGCAAATGGGCTTGTATAGCAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005399.3-1386s21c1
Sequence:CCGGCTAGACCGCTGCCCTACTTAACTCGAGTTAAGTAGGGCAGCGGTCTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-835s21c1
Sequence:CCGGCCCTGAGCCCAACCATGTTATCTCGAGATAACATGGTTGGGCTCAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-625s21c1
Sequence:CCGGTGAGGTGTTCGATGCTTTAAACTCGAGTTTAAAGCATCGAACACCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-446s21c1
Sequence:CCGGACCAAGATTCCACTGATTAAGCTCGAGCTTAATCAGTGGAATCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005399.3-1264s21c1
Sequence:GTACCGGCGCTGCAGGAATAACTATATACTCGAGTATATAGTTATTCCTGCAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005399.x-579s1c1
Sequence:CCGGGTATGCGTTTCGATCTGAGGACTCGAGTCCTCAGATCGAAACGCATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-174s1c1
Sequence:CCGGGTTTGTATCATGGCAGCAGGACTCGAGTCCTGCTGCCATGATACAAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005399.x-480s1c1
Sequence:CCGGTGAGGTGTTCGATGCTTTAAACTCGAGTTTAAAGCATCGAACACCTCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-299s1c1
Sequence:CCGGGCACCAAGATTCCACTGATTACTCGAGTAATCAGTGGAATCTTGGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-298s1c1
Sequence:CCGGAGCACCAAGATTCCACTGATTCTCGAGAATCAGTGGAATCTTGGTGCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005399.3-4851s1c1
Sequence:CCGGGCAGTAAGATTGGTGTGAAATCTCGAGATTTCACACCAATCTTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005399.3-4043s1c1
Sequence:CCGGCCACTCACTTTGCTCTAATTCCTCGAGGAATTAGAGCAAAGTGAGTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005399.3-2056s1c1
Sequence:CCGGGCCTTCCACATTCTTAGATTACTCGAGTAATCTAAGAATGTGGAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.3-866s1c1
Sequence:CCGGCTCTATGCATTGTCCATTAAGCTCGAGCTTAATGGACAATGCATAGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005399.3-773s1c1
Sequence:CCGGCCTCATCTACTTCAAGTTATTCTCGAGAATAACTTGAAGTAGATGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.3-634s1c1
Sequence:CCGGCGATGCTTTAAAGTTAGATTCCTCGAGGAATCTAACTTTAAAGCATCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005399
VALIDATED
PRKAB2 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, beta 2 non-catalytic subunit
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-579s21c1
Sequence:GTACCGGAGCTTGGCACAATTAACAATTCTCGAGAATTGTTAATTGTGCCAAGCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-337s21c1
Sequence:GTACCGGGGATTTGGAGGACTCCGTAAACTCGAGTTTACGGAGTCCTCCAAATCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-943s21c1
Sequence:CCGGTCTGCTATACAAGCCCATTTGCTCGAGCAAATGGGCTTGTATAGCAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005399.3-1386s21c1
Sequence:CCGGCTAGACCGCTGCCCTACTTAACTCGAGTTAAGTAGGGCAGCGGTCTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-835s21c1
Sequence:CCGGCCCTGAGCCCAACCATGTTATCTCGAGATAACATGGTTGGGCTCAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-625s21c1
Sequence:CCGGTGAGGTGTTCGATGCTTTAAACTCGAGTTTAAAGCATCGAACACCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000320529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-446s21c1
Sequence:CCGGACCAAGATTCCACTGATTAAGCTCGAGCTTAATCAGTGGAATCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005399.3-1264s21c1
Sequence:GTACCGGCGCTGCAGGAATAACTATATACTCGAGTATATAGTTATTCCTGCAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005399.x-579s1c1
Sequence:CCGGGTATGCGTTTCGATCTGAGGACTCGAGTCCTCAGATCGAAACGCATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-174s1c1
Sequence:CCGGGTTTGTATCATGGCAGCAGGACTCGAGTCCTGCTGCCATGATACAAACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005399.x-480s1c1
Sequence:CCGGTGAGGTGTTCGATGCTTTAAACTCGAGTTTAAAGCATCGAACACCTCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-299s1c1
Sequence:CCGGGCACCAAGATTCCACTGATTACTCGAGTAATCAGTGGAATCTTGGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-298s1c1
Sequence:CCGGAGCACCAAGATTCCACTGATTCTCGAGAATCAGTGGAATCTTGGTGCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005399.3-4851s1c1
Sequence:CCGGGCAGTAAGATTGGTGTGAAATCTCGAGATTTCACACCAATCTTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005399.3-4043s1c1
Sequence:CCGGCCACTCACTTTGCTCTAATTCCTCGAGGAATTAGAGCAAAGTGAGTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005399.3-2056s1c1
Sequence:CCGGGCCTTCCACATTCTTAGATTACTCGAGTAATCTAAGAATGTGGAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.3-866s1c1
Sequence:CCGGCTCTATGCATTGTCCATTAAGCTCGAGCTTAATGGACAATGCATAGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005399.3-773s1c1
Sequence:CCGGCCTCATCTACTTCAAGTTATTCTCGAGAATAACTTGAAGTAGATGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.3-634s1c1
Sequence:CCGGCGATGCTTTAAAGTTAGATTCCTCGAGGAATCTAACTTTAAAGCATCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005399
VALIDATED
PRKAB2 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, beta 2 non-catalytic subunit
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382364    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-579s21c1
Sequence:GTACCGGAGCTTGGCACAATTAACAATTCTCGAGAATTGTTAATTGTGCCAAGCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379961    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-337s21c1
Sequence:GTACCGGGGATTTGGAGGACTCCGTAAACTCGAGTTTACGGAGTCCTCCAAATCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-943s21c1
Sequence:CCGGTCTGCTATACAAGCCCATTTGCTCGAGCAAATGGGCTTGTATAGCAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005399.3-1386s21c1
Sequence:CCGGCTAGACCGCTGCCCTACTTAACTCGAGTTAAGTAGGGCAGCGGTCTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-835s21c1
Sequence:CCGGCCCTGAGCCCAACCATGTTATCTCGAGATAACATGGTTGGGCTCAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-625s21c1
Sequence:CCGGTGAGGTGTTCGATGCTTTAAACTCGAGTTTAAAGCATCGAACACCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000320529    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005399.3-446s21c1
Sequence:CCGGACCAAGATTCCACTGATTAAGCTCGAGCTTAATCAGTGGAATCTTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005399.3-1264s21c1
Sequence:GTACCGGCGCTGCAGGAATAACTATATACTCGAGTATATAGTTATTCCTGCAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_005399.x-579s1c1
Sequence:CCGGGTATGCGTTTCGATCTGAGGACTCGAGTCCTCAGATCGAAACGCATACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-174s1c1
Sequence:CCGGGTTTGTATCATGGCAGCAGGACTCGAGTCCTGCTGCCATGATACAAACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005399.x-480s1c1
Sequence:CCGGTGAGGTGTTCGATGCTTTAAACTCGAGTTTAAAGCATCGAACACCTCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-299s1c1
Sequence:CCGGGCACCAAGATTCCACTGATTACTCGAGTAATCAGTGGAATCTTGGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.x-298s1c1
Sequence:CCGGAGCACCAAGATTCCACTGATTCTCGAGAATCAGTGGAATCTTGGTGCTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196464    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005399.3-4851s1c1
Sequence:CCGGGCAGTAAGATTGGTGTGAAATCTCGAGATTTCACACCAATCTTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194809    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005399.3-4043s1c1
Sequence:CCGGCCACTCACTTTGCTCTAATTCCTCGAGGAATTAGAGCAAAGTGAGTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194837    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005399.3-2056s1c1
Sequence:CCGGGCCTTCCACATTCTTAGATTACTCGAGTAATCTAAGAATGTGGAAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.3-866s1c1
Sequence:CCGGCTCTATGCATTGTCCATTAAGCTCGAGCTTAATGGACAATGCATAGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005399.3-773s1c1
Sequence:CCGGCCTCATCTACTTCAAGTTATTCTCGAGAATAACTTGAAGTAGATGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005399.3-634s1c1
Sequence:CCGGCGATGCTTTAAAGTTAGATTCCTCGAGGAATCTAACTTTAAAGCATCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182997
PRKAB2 MISSION shRNA Bacterial Glycerol Stock
protein kinase, AMP-activated, beta 2 non-catalytic subunit
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-491s21c1
Sequence:CCGGCTCTGATAAAGAGTCATAATGCTCGAGCATTATGACTCTTTATCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182997.2-1168s21c1
Sequence:CCGGTATGAGTTCACGGAGTTTATTCTCGAGAATAAACTCCGTGAACTCATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-829s21c1
Sequence:CCGGCTTAACAAGGACACGAATATTCTCGAGAATATTCGTGTCCTTGTTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-770s21c1
Sequence:CCGGGATCTGAGGAGAGATTCAAATCTCGAGATTTGAATCTCTCCTCAGATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-116s1c1
Sequence:CCGGCATCGCTACAAGAAGAAGTATCTCGAGATACTTCTTCTTGTAGCGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-133s1c1
Sequence:CCGGGTATGTCACCACGCTGCTGTACTCGAGTACAGCAGCGTGGTGACATACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-144s1c1
Sequence:CCGGCGCTGCTGTATAAGCCCATCTCTCGAGAGATGGGCTTATACAGCAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-109s1c1
Sequence:CCGGCGCAACCCATCGCTACAAGAACTCGAGTTCTTGTAGCGATGGGTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-82s1c1
Sequence:CCGGCATTAAGGACAGTGTGATGGTCTCGAGACCATCACACTGTCCTTAATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182997
PRKAB2 MISSION shRNA shRNA Plasmid DNA
protein kinase, AMP-activated, beta 2 non-catalytic subunit
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-491s21c1
Sequence:CCGGCTCTGATAAAGAGTCATAATGCTCGAGCATTATGACTCTTTATCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182997.2-1168s21c1
Sequence:CCGGTATGAGTTCACGGAGTTTATTCTCGAGAATAAACTCCGTGAACTCATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-829s21c1
Sequence:CCGGCTTAACAAGGACACGAATATTCTCGAGAATATTCGTGTCCTTGTTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-770s21c1
Sequence:CCGGGATCTGAGGAGAGATTCAAATCTCGAGATTTGAATCTCTCCTCAGATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-116s1c1
Sequence:CCGGCATCGCTACAAGAAGAAGTATCTCGAGATACTTCTTCTTGTAGCGATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-133s1c1
Sequence:CCGGGTATGTCACCACGCTGCTGTACTCGAGTACAGCAGCGTGGTGACATACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-144s1c1
Sequence:CCGGCGCTGCTGTATAAGCCCATCTCTCGAGAGATGGGCTTATACAGCAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-109s1c1
Sequence:CCGGCGCAACCCATCGCTACAAGAACTCGAGTTCTTGTAGCGATGGGTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-82s1c1
Sequence:CCGGCATTAAGGACAGTGTGATGGTCTCGAGACCATCACACTGTCCTTAATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182997
PRKAB2 MISSION shRNA Lentiviral Transduction Particles
protein kinase, AMP-activated, beta 2 non-catalytic subunit
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-491s21c1
Sequence:CCGGCTCTGATAAAGAGTCATAATGCTCGAGCATTATGACTCTTTATCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361908    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182997.2-1168s21c1
Sequence:CCGGTATGAGTTCACGGAGTTTATTCTCGAGAATAAACTCCGTGAACTCATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-829s21c1
Sequence:CCGGCTTAACAAGGACACGAATATTCTCGAGAATATTCGTGTCCTTGTTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361952    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182997.2-770s21c1
Sequence:CCGGGATCTGAGGAGAGATTCAAATCTCGAGATTTGAATCTCTCCTCAGATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-116s1c1
Sequence:CCGGCATCGCTACAAGAAGAAGTATCTCGAGATACTTCTTCTTGTAGCGATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-133s1c1
Sequence:CCGGGTATGTCACCACGCTGCTGTACTCGAGTACAGCAGCGTGGTGACATACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-144s1c1
Sequence:CCGGCGCTGCTGTATAAGCCCATCTCTCGAGAGATGGGCTTATACAGCAGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-109s1c1
Sequence:CCGGCGCAACCCATCGCTACAAGAACTCGAGTTCTTGTAGCGATGGGTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182997.1-82s1c1
Sequence:CCGGCATTAAGGACAGTGTGATGGTCTCGAGACCATCACACTGTCCTTAATGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)