EMAIL THIS PAGE TO A FRIEND

PRKACA

protein kinase, cAMP-dependent, catalytic, alpha

68 Gene Product Result for
Synonyms: PKACA
UniProtKB ID: P17612, Q32P54, Q9H2Y0, Q9NRB4, Q9NRH9
Gene ID:
Human(5566) Summary: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is a member of the Ser/Thr protein kinase family and is a catalytic subunit of cAMP-dependent protein kinase. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]
Mouse(18747) protein kinase, cAMP dependent, catalytic, alpha
Rat(25636) protein kinase, cAMP-dependent, catalytic, alpha
naked mole-rat(101707235) protein kinase, cAMP-dependent, catalytic, alpha
domestic guinea pig(100735694) protein kinase, cAMP-dependent, catalytic, alpha
cow(282322) protein kinase, cAMP-dependent, catalytic, alpha
sheep(443094) protein kinase, cAMP-dependent, catalytic, alpha
Horse(100064302) protein kinase, cAMP-dependent, catalytic, alpha
domestic cat(101090494) protein kinase, cAMP-dependent, catalytic, alpha
dog(403556) protein kinase, cAMP-dependent, catalytic, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0748 AQUA Peptide TLGTGSFG[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002730 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002730 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002730 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008854 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008854 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008854 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002730 siRNAs that have been validated in the lab human pricing
NM_207518 siRNAs that have been validated in the lab human pricing
NM_001100922 Rosetta Predictions rat pricing
NM_008854 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002730 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217223 validated 485
2 SASI_Hs01_00217224 predicted 520
3 SASI_Hs01_00217225 predicted 729
4 SASI_Hs01_00217226 predicted 452
5 SASI_Hs01_00217227 predicted 972
6 SASI_Hs02_00334333 predicted 815
7 SASI_Hs01_00217230 predicted 499
8 SASI_Hs01_00217231 predicted 969
9 SASI_Hs01_00217232 predicted 1005
10 SASI_Hs02_00334334 predicted 1023
11 SASI_Hs01_00217228 predicted 461
12 SASI_Hs01_00217229 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207518 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160413 validated 281
2 SASI_Hs01_00160414 predicted 321
3 SASI_Hs01_00160415 predicted 531
4 SASI_Hs01_00160416 predicted 251
5 SASI_Hs01_00160417 predicted 779
6 SASI_Hs02_00374146 predicted 622
7 SASI_Hs01_00160420 predicted 300
8 SASI_Hs01_00160421 predicted 775
9 SASI_Hs01_00160422 predicted 810
10 SASI_Hs02_00374147 predicted 825
11 SASI_Hs01_00160418 predicted 265
12 SASI_Hs01_00160419 predicted 261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100922 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00210722 predicted 766
2 SASI_Rn02_00210723 predicted 664
3 SASI_Rn02_00210724 predicted 400
4 SASI_Rn02_00210725 predicted 306
5 SASI_Rn02_00210726 predicted 323
6 SASI_Rn02_00210727 predicted 671
7 SASI_Rn02_00210728 predicted 634
8 SASI_Rn02_00210729 predicted 565
9 SASI_Rn02_00210730 predicted 440
10 SASI_Rn02_00210731 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008854 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164955 predicted 429
2 SASI_Mm01_00164956 predicted 444
3 SASI_Mm01_00164957 predicted 905
4 SASI_Mm01_00164958 predicted 728
5 SASI_Mm01_00164959 predicted 464
6 SASI_Mm01_00164960 predicted 582
7 SASI_Mm01_00164961 predicted 967
8 SASI_Mm01_00164962 predicted 490
9 SASI_Mm01_00164963 predicted 426
10 SASI_Mm01_00164964 predicted 916
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002730
VALIDATED
PRKACA MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, catalytic, alpha
Human
20 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1416s21c1
Sequence:CCGGGATAATCAGAGGGACAGAAACCTCGAGGTTTCTGTCCCTCTGATTATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000367426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-724s21c1
Sequence:CCGGTTGACCAGCAGGGCTACATTCCTCGAGGAATGTAGCCCTGCTGGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1027s21c1
Sequence:CCGGTAGATCTCACCAAGCGCTTTGCTCGAGCAAAGCGCTTGGTGAGATCTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000356093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1676s21c1
Sequence:CCGGCCCACTTGCTAAGGGCAAATGCTCGAGCATTTGCCCTTAGCAAGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-533s1c1
Sequence:CCGGCAAGGACAACTCAAACTTATACTCGAGTATAAGTTTGAGTTGTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-1174s1c1
Sequence:CCGGCGAGTAACTTTGACGACTATGCTCGAGCATAGTCGTCAAAGTTACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-324s1c1
Sequence:CCGGGATCAGTTTGAACGAATCAAGCTCGAGCTTGATTCGTTCAAACTGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1707s21c1
Sequence:CCGGCAACCTTCCTTTCGGAGTAATCTCGAGATTACTCCGAAAGGAAGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-484s21c1
Sequence:CCGGTCCTGCAAGCTGTCAACTTTCCTCGAGGAAAGTTGACAGCTTGCAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-454s21c1
Sequence:CCGGAGATCGAACACACCCTGAATGCTCGAGCATTCAGGGTGTGTTCGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-538s1c1
Sequence:CCGGCTCAAACTTATACATGGTCATCTCGAGATGACCATGTATAAGTTTGAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-451s1c1
Sequence:CCGGGATCGAACACACCCTGAATGACTCGAGTCATTCAGGGTGTGTTCGATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-1199s1c1
Sequence:CCGGGAAATCCGGGTCTCCATCAATCTCGAGATTGATGGAGACCCGGATTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-432s1c1
Sequence:CCGGAGGTGGTGAAACTGAAACAGACTCGAGTCTGTTTCAGTTTCACCACCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-313s21c1
Sequence:CCGGCAGCCCACTTGGATCAGTTTGCTCGAGCAAACTGATCCAAGTGGGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-833s1c1
Sequence:CCGGCCTGAGCAAAGGCTACAACAACTCGAGTTGTTGTAGCCTTTGCTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.3-1707s1c1
Sequence:CCGGCAACCTTCCTTTCGGAGTAATCTCGAGATTACTCCGAAAGGAAGGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.x-1401s1c1
Sequence:CCGGCAGGAAGCCCAGATAATCAGACTCGAGTCTGATTATCTGGGCTTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-532s21c1
Sequence:CCGGTCAAGGACAACTCAAACTTATCTCGAGATAAGTTTGAGTTGTCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.3-1349s1c1
Sequence:CCGGCCAGAGTTCCTTGCATCTAATCTCGAGATTAGATGCAAGGAACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002730
VALIDATED
PRKACA MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, catalytic, alpha
Human
20 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1416s21c1
Sequence:CCGGGATAATCAGAGGGACAGAAACCTCGAGGTTTCTGTCCCTCTGATTATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-724s21c1
Sequence:CCGGTTGACCAGCAGGGCTACATTCCTCGAGGAATGTAGCCCTGCTGGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1027s21c1
Sequence:CCGGTAGATCTCACCAAGCGCTTTGCTCGAGCAAAGCGCTTGGTGAGATCTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1676s21c1
Sequence:CCGGCCCACTTGCTAAGGGCAAATGCTCGAGCATTTGCCCTTAGCAAGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-533s1c1
Sequence:CCGGCAAGGACAACTCAAACTTATACTCGAGTATAAGTTTGAGTTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-1174s1c1
Sequence:CCGGCGAGTAACTTTGACGACTATGCTCGAGCATAGTCGTCAAAGTTACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-324s1c1
Sequence:CCGGGATCAGTTTGAACGAATCAAGCTCGAGCTTGATTCGTTCAAACTGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1707s21c1
Sequence:CCGGCAACCTTCCTTTCGGAGTAATCTCGAGATTACTCCGAAAGGAAGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-484s21c1
Sequence:CCGGTCCTGCAAGCTGTCAACTTTCCTCGAGGAAAGTTGACAGCTTGCAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-454s21c1
Sequence:CCGGAGATCGAACACACCCTGAATGCTCGAGCATTCAGGGTGTGTTCGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-538s1c1
Sequence:CCGGCTCAAACTTATACATGGTCATCTCGAGATGACCATGTATAAGTTTGAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-451s1c1
Sequence:CCGGGATCGAACACACCCTGAATGACTCGAGTCATTCAGGGTGTGTTCGATCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-1199s1c1
Sequence:CCGGGAAATCCGGGTCTCCATCAATCTCGAGATTGATGGAGACCCGGATTTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-432s1c1
Sequence:CCGGAGGTGGTGAAACTGAAACAGACTCGAGTCTGTTTCAGTTTCACCACCTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-313s21c1
Sequence:CCGGCAGCCCACTTGGATCAGTTTGCTCGAGCAAACTGATCCAAGTGGGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-833s1c1
Sequence:CCGGCCTGAGCAAAGGCTACAACAACTCGAGTTGTTGTAGCCTTTGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.3-1707s1c1
Sequence:CCGGCAACCTTCCTTTCGGAGTAATCTCGAGATTACTCCGAAAGGAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.x-1401s1c1
Sequence:CCGGCAGGAAGCCCAGATAATCAGACTCGAGTCTGATTATCTGGGCTTCCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-532s21c1
Sequence:CCGGTCAAGGACAACTCAAACTTATCTCGAGATAAGTTTGAGTTGTCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.3-1349s1c1
Sequence:CCGGCCAGAGTTCCTTGCATCTAATCTCGAGATTAGATGCAAGGAACTCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002730
VALIDATED
PRKACA MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, catalytic, alpha
Human
20 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367487    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1416s21c1
Sequence:CCGGGATAATCAGAGGGACAGAAACCTCGAGGTTTCTGTCCCTCTGATTATCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000367426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-724s21c1
Sequence:CCGGTTGACCAGCAGGGCTACATTCCTCGAGGAATGTAGCCCTGCTGGTCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356094    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1027s21c1
Sequence:CCGGTAGATCTCACCAAGCGCTTTGCTCGAGCAAAGCGCTTGGTGAGATCTATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000356093    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1676s21c1
Sequence:CCGGCCCACTTGCTAAGGGCAAATGCTCGAGCATTTGCCCTTAGCAAGTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-533s1c1
Sequence:CCGGCAAGGACAACTCAAACTTATACTCGAGTATAAGTTTGAGTTGTCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-1174s1c1
Sequence:CCGGCGAGTAACTTTGACGACTATGCTCGAGCATAGTCGTCAAAGTTACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-324s1c1
Sequence:CCGGGATCAGTTTGAACGAATCAAGCTCGAGCTTGATTCGTTCAAACTGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233528    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-1707s21c1
Sequence:CCGGCAACCTTCCTTTCGGAGTAATCTCGAGATTACTCCGAAAGGAAGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-484s21c1
Sequence:CCGGTCCTGCAAGCTGTCAACTTTCCTCGAGGAAAGTTGACAGCTTGCAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-454s21c1
Sequence:CCGGAGATCGAACACACCCTGAATGCTCGAGCATTCAGGGTGTGTTCGATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-538s1c1
Sequence:CCGGCTCAAACTTATACATGGTCATCTCGAGATGACCATGTATAAGTTTGAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-451s1c1
Sequence:CCGGGATCGAACACACCCTGAATGACTCGAGTCATTCAGGGTGTGTTCGATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-1199s1c1
Sequence:CCGGGAAATCCGGGTCTCCATCAATCTCGAGATTGATGGAGACCCGGATTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.x-432s1c1
Sequence:CCGGAGGTGGTGAAACTGAAACAGACTCGAGTCTGTTTCAGTTTCACCACCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233525    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-313s21c1
Sequence:CCGGCAGCCCACTTGGATCAGTTTGCTCGAGCAAACTGATCCAAGTGGGCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002730.3-833s1c1
Sequence:CCGGCCTGAGCAAAGGCTACAACAACTCGAGTTGTTGTAGCCTTTGCTCAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194783    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.3-1707s1c1
Sequence:CCGGCAACCTTCCTTTCGGAGTAATCTCGAGATTACTCCGAAAGGAAGGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001370    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.x-1401s1c1
Sequence:CCGGCAGGAAGCCCAGATAATCAGACTCGAGTCTGATTATCTGGGCTTCCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002730.3-532s21c1
Sequence:CCGGTCAAGGACAACTCAAACTTATCTCGAGATAAGTTTGAGTTGTCCTTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194744    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002730.3-1349s1c1
Sequence:CCGGCCAGAGTTCCTTGCATCTAATCTCGAGATTAGATGCAAGGAACTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008854
VALIDATED
PRKACA MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, catalytic, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-325s21c1
Sequence:CCGGCCCAGTTGGATCAGTTTGATACTCGAGTATCAAACTGATCCAACTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-831s21c1
Sequence:CCGGCCCGAGATTATCCTGAGCAAACTCGAGTTTGCTCAGGATAATCTCGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-1181s21c1
Sequence:CCGGCACGAGTAACTTTGACGACTACTCGAGTAGTCGTCAAAGTTACTCGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008854.4-2107s21c1
Sequence:CCGGCCTGTGTTTATCCCTCTCGTACTCGAGTACGAGAGGGATAAACACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-989s21c1
Sequence:CCGGCCACTTCAGCTCTGACTTGAACTCGAGTTCAAGTCAGAGCTGAAGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-315s1c1
Sequence:CCGGCCCAGTTGGATCAGTTTGATACTCGAGTATCAAACTGATCCAACTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-979s1c1
Sequence:CCGGCCACTTCAGCTCTGACTTGAACTCGAGTTCAAGTCAGAGCTGAAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-1171s1c1
Sequence:CCGGCACGAGTAACTTTGACGACTACTCGAGTAGTCGTCAAAGTTACTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008854.3-821s1c1
Sequence:CCGGCCCGAGATTATCCTGAGCAAACTCGAGTTTGCTCAGGATAATCTCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008854.3-2098s1c1
Sequence:CCGGCCTGTGTTTATCCCTCTCGTACTCGAGTACGAGAGGGATAAACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008854
VALIDATED
PRKACA MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, catalytic, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-325s21c1
Sequence:CCGGCCCAGTTGGATCAGTTTGATACTCGAGTATCAAACTGATCCAACTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-831s21c1
Sequence:CCGGCCCGAGATTATCCTGAGCAAACTCGAGTTTGCTCAGGATAATCTCGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-1181s21c1
Sequence:CCGGCACGAGTAACTTTGACGACTACTCGAGTAGTCGTCAAAGTTACTCGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008854.4-2107s21c1
Sequence:CCGGCCTGTGTTTATCCCTCTCGTACTCGAGTACGAGAGGGATAAACACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-989s21c1
Sequence:CCGGCCACTTCAGCTCTGACTTGAACTCGAGTTCAAGTCAGAGCTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-315s1c1
Sequence:CCGGCCCAGTTGGATCAGTTTGATACTCGAGTATCAAACTGATCCAACTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-979s1c1
Sequence:CCGGCCACTTCAGCTCTGACTTGAACTCGAGTTCAAGTCAGAGCTGAAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-1171s1c1
Sequence:CCGGCACGAGTAACTTTGACGACTACTCGAGTAGTCGTCAAAGTTACTCGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008854.3-821s1c1
Sequence:CCGGCCCGAGATTATCCTGAGCAAACTCGAGTTTGCTCAGGATAATCTCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008854.3-2098s1c1
Sequence:CCGGCCTGTGTTTATCCCTCTCGTACTCGAGTACGAGAGGGATAAACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008854
VALIDATED
PRKACA MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, catalytic, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-325s21c1
Sequence:CCGGCCCAGTTGGATCAGTTTGATACTCGAGTATCAAACTGATCCAACTGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-831s21c1
Sequence:CCGGCCCGAGATTATCCTGAGCAAACTCGAGTTTGCTCAGGATAATCTCGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344984    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-1181s21c1
Sequence:CCGGCACGAGTAACTTTGACGACTACTCGAGTAGTCGTCAAAGTTACTCGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008854.4-2107s21c1
Sequence:CCGGCCTGTGTTTATCCCTCTCGTACTCGAGTACGAGAGGGATAAACACAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008854.4-989s21c1
Sequence:CCGGCCACTTCAGCTCTGACTTGAACTCGAGTTCAAGTCAGAGCTGAAGTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012460    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-315s1c1
Sequence:CCGGCCCAGTTGGATCAGTTTGATACTCGAGTATCAAACTGATCCAACTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-979s1c1
Sequence:CCGGCCACTTCAGCTCTGACTTGAACTCGAGTTCAAGTCAGAGCTGAAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012462    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008854.3-1171s1c1
Sequence:CCGGCACGAGTAACTTTGACGACTACTCGAGTAGTCGTCAAAGTTACTCGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012459    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008854.3-821s1c1
Sequence:CCGGCCCGAGATTATCCTGAGCAAACTCGAGTTTGCTCAGGATAATCTCGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008854.3-2098s1c1
Sequence:CCGGCCTGTGTTTATCCCTCTCGTACTCGAGTACGAGAGGGATAAACACAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)