EMAIL THIS PAGE TO A FRIEND

PRKACB

protein kinase, cAMP-dependent, catalytic, beta

216 Gene Product Result for
Synonyms: PKACB
Gene ID:
Human(5567) Summary: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is a member of the Ser/Thr protein kinase family and is a catalytic subunit of cAMP-dependent protein kinase. Several alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jun 2011]
Mouse(18749) protein kinase, cAMP dependent, catalytic, beta
Rat(293508) protein kinase, cAMP dependent, catalytic, beta
Zebrafish(100538234) protein kinase, cAMP-dependent, catalytic, beta
chicken(424542) protein kinase, cAMP-dependent, catalytic, beta
domestic cat(101095353) protein kinase, cAMP-dependent, catalytic, beta
dog(479975) protein kinase, cAMP-dependent, catalytic, beta
cow(282323) protein kinase, cAMP-dependent, catalytic, beta
sheep(101108785) protein kinase, cAMP-dependent, catalytic, beta
domestic guinea pig(100712694) protein kinase, cAMP-dependent, catalytic, beta
naked mole-rat(101721558) protein kinase, cAMP-dependent, catalytic, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
SML0428 GSK690693 ≥98% (HPLC) human pricing
H5257 Hispidin solid, ≥98% (HPLC) human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0748 AQUA Peptide TLGTGSFG[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011100 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011100 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011100 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002731 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002731 siRNAs that have been validated in the lab human pricing
NM_182948 siRNAs that have been validated in the lab human pricing
NM_207578 siRNAs that have been validated in the lab human pricing
NM_001077645 Rosetta Predictions rat pricing
NM_011100 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002731 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00143767 validated 721
2 SASI_Hs01_00143768 predicted 748
3 SASI_Hs01_00143769 predicted 514
4 SASI_Hs01_00143770 predicted 694
5 SASI_Hs01_00143771 predicted 512
6 SASI_Hs01_00143772 predicted 786
7 SASI_Hs01_00143773 predicted 704
8 SASI_Hs01_00143774 predicted 685
9 SASI_Hs01_00143775 predicted 693
10 SASI_Hs01_00143776 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182948 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188721 validated 696
2 SASI_Hs01_00188722 predicted 714
3 SASI_Hs01_00188723 predicted 483
4 SASI_Hs01_00188724 predicted 657
5 SASI_Hs01_00188725 predicted 481
6 SASI_Hs01_00188726 predicted 754
7 SASI_Hs01_00188727 predicted 672
8 SASI_Hs01_00188728 predicted 658
9 SASI_Hs01_00188729 predicted 658
10 SASI_Hs01_00188730 predicted 764
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207578 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068057 validated 726
2 SASI_Hs01_00068058 predicted 742
3 SASI_Hs01_00068059 predicted 509
4 SASI_Hs01_00068060 predicted 687
5 SASI_Hs01_00068061 predicted 513
6 SASI_Hs01_00068062 predicted 789
7 SASI_Hs01_00068063 predicted 708
8 SASI_Hs01_00068064 predicted 684
9 SASI_Hs01_00068065 predicted 690
10 SASI_Hs01_00068066 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00207682 predicted 781
2 SASI_Rn02_00207683 predicted 674
3 SASI_Rn02_00207684 predicted 716
4 SASI_Rn02_00207685 predicted 834
5 SASI_Rn02_00207686 predicted 494
6 SASI_Rn02_00207687 predicted 300
7 SASI_Rn02_00207688 predicted 881
8 SASI_Rn02_00207689 predicted 588
9 SASI_Rn02_00207690 predicted 685
10 SASI_Rn02_00207691 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186747 predicted 1248
2 SASI_Mm02_00319891 predicted 1237
3 SASI_Mm01_00186748 predicted 414
4 SASI_Mm01_00186749 predicted 1221
5 SASI_Mm01_00186750 predicted 1142
6 SASI_Mm01_00186751 predicted 499
7 SASI_Mm01_00186752 predicted 968
8 SASI_Mm01_00186753 predicted 621
9 SASI_Mm01_00186754 predicted 693
10 SASI_Mm01_00186755 predicted 1070
11 SASI_Mm01_00186756 predicted 1191
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011100
PRKACB MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, catalytic, beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-880s1c1
Sequence:CCGGCCTCAGCAAGGGTTACAATAACTCGAGTTATTGTAACCCTTGCTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-419s1c1
Sequence:CCGGGTCATGTTGGTGAAGCATAAACTCGAGTTTATGCTTCACCAACATGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-692s1c1
Sequence:CCGGGCCCAGATTGTGCTAACATTTCTCGAGAAATGTTAGCACAATCTGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1089s21c1
Sequence:CCGGGTGGATCTGACAAAGCGATTCCTCGAGGAATCGCTTTGTCAGATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-488s21c1
Sequence:CCGGAGACAAGCAGAAGGTTGTTAACTCGAGTTAACAACCTTCTGCTTGTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000425543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1265s21c1
Sequence:CCGGAGAAATCCGTGTGTCTATAACCTCGAGGTTATAGACACACGGATTTCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000424524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1121s21c1
Sequence:CCGGGAACGGCGTGAGTGACATAAACTCGAGTTTATGTCACTCACGCCGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011100
PRKACB MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, catalytic, beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-880s1c1
Sequence:CCGGCCTCAGCAAGGGTTACAATAACTCGAGTTATTGTAACCCTTGCTGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-419s1c1
Sequence:CCGGGTCATGTTGGTGAAGCATAAACTCGAGTTTATGCTTCACCAACATGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-692s1c1
Sequence:CCGGGCCCAGATTGTGCTAACATTTCTCGAGAAATGTTAGCACAATCTGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000423531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1089s21c1
Sequence:CCGGGTGGATCTGACAAAGCGATTCCTCGAGGAATCGCTTTGTCAGATCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000436569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-488s21c1
Sequence:CCGGAGACAAGCAGAAGGTTGTTAACTCGAGTTAACAACCTTCTGCTTGTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000425543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1265s21c1
Sequence:CCGGAGAAATCCGTGTGTCTATAACCTCGAGGTTATAGACACACGGATTTCTTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000424524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1121s21c1
Sequence:CCGGGAACGGCGTGAGTGACATAAACTCGAGTTTATGTCACTCACGCCGTTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011100
PRKACB MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, catalytic, beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022816    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-880s1c1
Sequence:CCGGCCTCAGCAAGGGTTACAATAACTCGAGTTATTGTAACCCTTGCTGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-419s1c1
Sequence:CCGGGTCATGTTGGTGAAGCATAAACTCGAGTTTATGCTTCACCAACATGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011100.3-692s1c1
Sequence:CCGGGCCCAGATTGTGCTAACATTTCTCGAGAAATGTTAGCACAATCTGGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423531    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1089s21c1
Sequence:CCGGGTGGATCTGACAAAGCGATTCCTCGAGGAATCGCTTTGTCAGATCCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-488s21c1
Sequence:CCGGAGACAAGCAGAAGGTTGTTAACTCGAGTTAACAACCTTCTGCTTGTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000425543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1265s21c1
Sequence:CCGGAGAAATCCGTGTGTCTATAACCTCGAGGTTATAGACACACGGATTTCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000424524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011100.4-1121s21c1
Sequence:CCGGGAACGGCGTGAGTGACATAAACTCGAGTTTATGTCACTCACGCCGTTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002731
VALIDATED
PRKACB MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, catalytic, beta
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002731.2-2103s1c1
Sequence:CCGGCCAGCATTTCTGTAGGTATTACTCGAGTAATACCTACAGAAATGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-461s1c1
Sequence:CCGGCTGAACAGTATTATGCCATGACTCGAGTCATGGCATAATACTGTTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-722s1c1
Sequence:CCGGAGGAGTGCTAATCTATGAAATCTCGAGATTTCATAGATTAGCACTCCTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-518s1c1
Sequence:CCGGCCTCCATTCACTAGACCTCATCTCGAGATGAGGTCTAGTGAATGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-2459s1c1
Sequence:CCGGGCCAACTGACTTAACAACATTCTCGAGAATGTTGTTAAGTCAGTTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-944s1c1
Sequence:CCGGCACGACAGATTGGATTGCTATCTCGAGATAGCAATCCAATCTGTCGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-150s1c1
Sequence:CCGGACTCAGAATAATGCCGGACTTCTCGAGAAGTCCGGCATTATTCTGAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002731.2-1710s1c1
Sequence:CCGGCAGTAGTTATTGCCAATATTGCTCGAGCAATATTGGCAATAACTACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002731.2-1238s1c1
Sequence:CCGGCCAGCAACTTTGATGACTATGCTCGAGCATAGTCATCAAAGTTGCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-523s1c1
Sequence:CCGGGAGCATACTTTGAATGAGAAACTCGAGTTTCTCATTCAAAGTATGCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-709s1c1
Sequence:CCGGGCTCAGATAGTGCTAACATTCCTCGAGGAATGTTAGCACTATCTGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002731
VALIDATED
PRKACB MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, catalytic, beta
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002731.2-2103s1c1
Sequence:CCGGCCAGCATTTCTGTAGGTATTACTCGAGTAATACCTACAGAAATGCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-461s1c1
Sequence:CCGGCTGAACAGTATTATGCCATGACTCGAGTCATGGCATAATACTGTTCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-722s1c1
Sequence:CCGGAGGAGTGCTAATCTATGAAATCTCGAGATTTCATAGATTAGCACTCCTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-518s1c1
Sequence:CCGGCCTCCATTCACTAGACCTCATCTCGAGATGAGGTCTAGTGAATGGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-2459s1c1
Sequence:CCGGGCCAACTGACTTAACAACATTCTCGAGAATGTTGTTAAGTCAGTTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-944s1c1
Sequence:CCGGCACGACAGATTGGATTGCTATCTCGAGATAGCAATCCAATCTGTCGTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000002005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-150s1c1
Sequence:CCGGACTCAGAATAATGCCGGACTTCTCGAGAAGTCCGGCATTATTCTGAGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002731.2-1710s1c1
Sequence:CCGGCAGTAGTTATTGCCAATATTGCTCGAGCAATATTGGCAATAACTACTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002731.2-1238s1c1
Sequence:CCGGCCAGCAACTTTGATGACTATGCTCGAGCATAGTCATCAAAGTTGCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-523s1c1
Sequence:CCGGGAGCATACTTTGAATGAGAAACTCGAGTTTCTCATTCAAAGTATGCTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-709s1c1
Sequence:CCGGGCTCAGATAGTGCTAACATTCCTCGAGGAATGTTAGCACTATCTGAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002731
VALIDATED
PRKACB MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, catalytic, beta
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195200    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A3
TRC Version: 1 Clone ID:NM_002731.2-2103s1c1
Sequence:CCGGCCAGCATTTCTGTAGGTATTACTCGAGTAATACCTACAGAAATGCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-461s1c1
Sequence:CCGGCTGAACAGTATTATGCCATGACTCGAGTCATGGCATAATACTGTTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-722s1c1
Sequence:CCGGAGGAGTGCTAATCTATGAAATCTCGAGATTTCATAGATTAGCACTCCTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002003    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-518s1c1
Sequence:CCGGCCTCCATTCACTAGACCTCATCTCGAGATGAGGTCTAGTGAATGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002004    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-2459s1c1
Sequence:CCGGGCCAACTGACTTAACAACATTCTCGAGAATGTTGTTAAGTCAGTTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-944s1c1
Sequence:CCGGCACGACAGATTGGATTGCTATCTCGAGATAGCAATCCAATCTGTCGTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.x-150s1c1
Sequence:CCGGACTCAGAATAATGCCGGACTTCTCGAGAAGTCCGGCATTATTCTGAGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195126    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002731.2-1710s1c1
Sequence:CCGGCAGTAGTTATTGCCAATATTGCTCGAGCAATATTGGCAATAACTACTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002731.2-1238s1c1
Sequence:CCGGCCAGCAACTTTGATGACTATGCTCGAGCATAGTCATCAAAGTTGCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196263    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-523s1c1
Sequence:CCGGGAGCATACTTTGAATGAGAAACTCGAGTTTCTCATTCAAAGTATGCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196664    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002731.2-709s1c1
Sequence:CCGGGCTCAGATAGTGCTAACATTCCTCGAGGAATGTTAGCACTATCTGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)