EMAIL THIS PAGE TO A FRIEND

PRKACG

protein kinase, cAMP-dependent, catalytic, gamma

33 Gene Product Result for
Synonyms: KAPG PKACg
Species: Human PRKACG(5568)
UniProtKB ID: P22612, O60850, Q5VZ02, Q86YI1
Gene ID:
Human(5568) Summary: Cyclic AMP-dependent protein kinase (PKA) consists of two catalytic subunits and a regulatory subunit dimer. This gene encodes the gamma form of its catalytic subunit. The gene is intronless and is thought to be a retrotransposon derived from the gene for the alpha form of the PKA catalytic subunit. [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
SML0428 GSK690693 ≥98% (HPLC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002732 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002732 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186185 predicted 830
2 SASI_Hs01_00186186 predicted 903
3 SASI_Hs01_00186187 predicted 1206
4 SASI_Hs01_00186189 predicted 784
5 SASI_Hs01_00186190 predicted 1195
6 SASI_Hs01_00186191 predicted 861
7 SASI_Hs01_00186192 predicted 253
8 SASI_Hs01_00186193 predicted 933
9 SASI_Hs02_00334335 predicted 295
10 SASI_Hs02_00334336 predicted 311
11 SASI_Hs01_00186188 predicted 1277
12 SASI_Hs01_00186194 predicted 1211
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002732
PRKACG MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, catalytic, gamma
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-211s1c1
Sequence:CCGGGCCATGAAGATCCTCAACAAGCTCGAGCTTGTTGAGGATCTTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-69s1c1
Sequence:CCGGCAGAGGAGATTTCCTCTACAGCTCGAGCTGTAGAGGAAATCTCCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002732.2-1146s1c1
Sequence:CCGGCCAGAGTTCCTTGTATCTAATCTCGAGATTAGATACAAGGAACTCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-46s1c1
Sequence:CCGGGTGAACGAGTTCCTAGCCAAACTCGAGTTTGGCTAGGAACTCGTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022354    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002732.2-1528s1c1
Sequence:CCGGAGTGGGCTGTTTGCTAGAATACTCGAGTATTCTAGCAAACAGCCCACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-264s1c1
Sequence:CCGGCATACTGAACGAGAAGCGCATCTCGAGATGCGCTTCTCGTTCAGTATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-263s1c1
Sequence:CCGGACATACTGAACGAGAAGCGCACTCGAGTGCGCTTCTCGTTCAGTATGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-265s1c1
Sequence:CCGGATACTGAACGAGAAGCGCATCCTCGAGGATGCGCTTCTCGTTCAGTATTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002732
PRKACG MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, catalytic, gamma
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-211s1c1
Sequence:CCGGGCCATGAAGATCCTCAACAAGCTCGAGCTTGTTGAGGATCTTCATGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-69s1c1
Sequence:CCGGCAGAGGAGATTTCCTCTACAGCTCGAGCTGTAGAGGAAATCTCCTCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002732.2-1146s1c1
Sequence:CCGGCCAGAGTTCCTTGTATCTAATCTCGAGATTAGATACAAGGAACTCTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-46s1c1
Sequence:CCGGGTGAACGAGTTCCTAGCCAAACTCGAGTTTGGCTAGGAACTCGTTCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022354    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002732.2-1528s1c1
Sequence:CCGGAGTGGGCTGTTTGCTAGAATACTCGAGTATTCTAGCAAACAGCCCACTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-264s1c1
Sequence:CCGGCATACTGAACGAGAAGCGCATCTCGAGATGCGCTTCTCGTTCAGTATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-263s1c1
Sequence:CCGGACATACTGAACGAGAAGCGCACTCGAGTGCGCTTCTCGTTCAGTATGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-265s1c1
Sequence:CCGGATACTGAACGAGAAGCGCATCCTCGAGGATGCGCTTCTCGTTCAGTATTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002732
PRKACG MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, catalytic, gamma
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-211s1c1
Sequence:CCGGGCCATGAAGATCCTCAACAAGCTCGAGCTTGTTGAGGATCTTCATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-69s1c1
Sequence:CCGGCAGAGGAGATTTCCTCTACAGCTCGAGCTGTAGAGGAAATCTCCTCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194745    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002732.2-1146s1c1
Sequence:CCGGCCAGAGTTCCTTGTATCTAATCTCGAGATTAGATACAAGGAACTCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-46s1c1
Sequence:CCGGGTGAACGAGTTCCTAGCCAAACTCGAGTTTGGCTAGGAACTCGTTCACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022354    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_002732.2-1528s1c1
Sequence:CCGGAGTGGGCTGTTTGCTAGAATACTCGAGTATTCTAGCAAACAGCCCACTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022355    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-264s1c1
Sequence:CCGGCATACTGAACGAGAAGCGCATCTCGAGATGCGCTTCTCGTTCAGTATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-263s1c1
Sequence:CCGGACATACTGAACGAGAAGCGCACTCGAGTGCGCTTCTCGTTCAGTATGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022357    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002732.2-265s1c1
Sequence:CCGGATACTGAACGAGAAGCGCATCCTCGAGGATGCGCTTCTCGTTCAGTATTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)