EMAIL THIS PAGE TO A FRIEND

PRKAR1A

protein kinase, cAMP-dependent, regulatory, type I, alpha

117 Gene Product Result for
Synonyms: ACRDYS1 ADOHR CAR CNC CNC1 PKR1 PPNAD1 PRKAR1 TSE1
UniProtKB ID: P10644, Q567S7
Gene ID:
Human(5573) Summary: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. This gene encodes one of the regulatory subunits. This protein was found to be a tissue-specific extinguisher that down-regulates the expression of seven liver genes in hepatoma x fibroblast hybrids. Mutations in this gene cause Carney complex (CNC). This gene can fuse to the RET protooncogene by gene rearrangement and form the thyroid tumor-specific chimeric oncogene known as PTC2. A nonconventional nuclear localization sequence (NLS) has been found for this protein which suggests a role in DNA replication via the protein serving as a nuclear transport protein for the second subunit of the Replication Factor C (RFC40). Several alternatively spliced transcript variants encoding two different isoforms have been observed. [provided by RefSeq, Jan 2013]
Mouse(19084) protein kinase, cAMP dependent regulatory, type I, alpha
Rat(25725) protein kinase, cAMP-dependent, regulatory, type I, alpha
chicken(417438) protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)
dog(480459) protein kinase, cAMP-dependent, regulatory, type I, alpha
domestic cat(101088632) protein kinase, cAMP-dependent, regulatory, type I, alpha
cow(615074) protein kinase, cAMP-dependent, regulatory, type I, alpha (tissue specific extinguisher 1)
sheep(100216463) protein kinase, cAMP-dependent, regulatory, type I, alpha
domestic guinea pig(100729787) protein kinase, cAMP-dependent, regulatory, type I, alpha
naked mole-rat(101722786) protein kinase, cAMP-dependent, regulatory, type I, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021880 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021880 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021880 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002734 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002734 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002734 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002734 siRNAs that have been validated in the lab human pricing
NM_212471 siRNAs that have been validated in the lab human pricing
NM_212472 siRNAs that have been validated in the lab human pricing
NM_013181 Rosetta Predictions rat pricing
NM_021880 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002734 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116785 validated 880
1 SASI_Hs01_00116786 validated 746
1 SASI_Hs01_00116787 validated 1349
2 SASI_Hs01_00116789 predicted 359
3 SASI_Hs01_00116790 predicted 369
4 SASI_Hs01_00116791 predicted 351
5 SASI_Hs01_00116793 predicted 1120
6 SASI_Hs02_00334338 predicted 491
7 SASI_Hs01_00116794 predicted 887
8 SASI_Hs02_00334339 predicted 1334
9 SASI_Hs02_00334340 predicted 866
10 SASI_Hs01_00116788 predicted 1061
11 SASI_Hs01_00116792 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212471 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00213593 validated 907
2 SASI_Hs01_00213594 predicted 775
3 SASI_Hs01_00213595 predicted 1373
4 SASI_Hs01_00213597 predicted 379
5 SASI_Hs01_00213598 predicted 399
6 SASI_Hs01_00213599 predicted 376
7 SASI_Hs01_00213601 predicted 1154
8 SASI_Hs02_00374192 predicted 512
9 SASI_Hs01_00213602 predicted 917
10 SASI_Hs02_00374193 predicted 1359
11 SASI_Hs02_00374194 predicted 890
12 SASI_Hs01_00213596 predicted 1090
13 SASI_Hs01_00213600 predicted 737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212472 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202466 validated 920
2 SASI_Hs01_00202467 predicted 777
3 SASI_Hs01_00202468 predicted 1372
4 SASI_Hs01_00202470 predicted 386
5 SASI_Hs02_00374195 predicted 402
6 SASI_Hs01_00202471 predicted 381
7 SASI_Hs01_00202473 predicted 1155
8 SASI_Hs01_00202474 predicted 520
9 SASI_Hs01_00202475 predicted 917
10 SASI_Hs02_00374196 predicted 1359
11 SASI_Hs02_00374197 predicted 896
12 SASI_Hs01_00202469 predicted 1086
13 SASI_Hs01_00202472 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013181 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046080 predicted 953
2 SASI_Rn02_00261011 predicted 1062
3 SASI_Rn01_00046081 predicted 924
4 SASI_Rn01_00046082 predicted 279
5 SASI_Rn01_00046084 predicted 1201
6 SASI_Rn01_00046085 predicted 293
7 SASI_Rn01_00046086 predicted 836
8 SASI_Rn01_00046087 predicted 389
9 SASI_Rn01_00046088 predicted 1117
10 SASI_Rn01_00046089 predicted 433
11 SASI_Rn01_00046083 predicted 570
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021880 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077528 predicted 618
2 SASI_Mm01_00077529 predicted 421
3 SASI_Mm01_00077530 predicted 1157
4 SASI_Mm01_00077531 predicted 966
5 SASI_Mm01_00077532 predicted 997
6 SASI_Mm01_00077533 predicted 1106
7 SASI_Mm01_00077534 predicted 423
8 SASI_Mm01_00077535 predicted 469
9 SASI_Mm01_00077536 predicted 1160
10 SASI_Mm01_00077537 predicted 866
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021880
VALIDATED
PRKAR1A MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type I, alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-666s21c1
Sequence:CCGGCAAGGAGAAATGGATGTCTATCTCGAGATAGACATCCATTTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-606s21c1
Sequence:CCGGATTGCTGGAGAGACGGTTATTCTCGAGAATAACCGTCTCTCCAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-1160s21c1
Sequence:CCGGCCCTTTGAAGTGCGTTAAGTTCTCGAGAACTTAACGCACTTCAAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-877s21c1
Sequence:CCGGTCCTTAGTAAAGTGTCTATTTCTCGAGAAATAGACACTTTACTAAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-667s1c1
Sequence:CCGGCAAGGAGAAATGGATGTCTATCTCGAGATAGACATCCATTTCTCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-1161s1c1
Sequence:CCGGCCCTTTGAAGTGCGTTAAGTTCTCGAGAACTTAACGCACTTCAAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-770s1c1
Sequence:CCGGCCACTGTCAAAGCAAAGACAACTCGAGTTGTCTTTGCTTTGACAGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021880.1-464s1c1
Sequence:CCGGCCTCCTACGTTAGAAAGGTTACTCGAGTAACCTTTCTAACGTAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021880.2-1750s21c1
Sequence:CCGGGCCTGTAATTAAGCTAGTTTACTCGAGTAAACTAGCTTAATTACAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-274s1c1
Sequence:CCGGGCATTCCTTCGGGAATACTTTCTCGAGAAAGTATTCCCGAAGGAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021880
VALIDATED
PRKAR1A MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type I, alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-666s21c1
Sequence:CCGGCAAGGAGAAATGGATGTCTATCTCGAGATAGACATCCATTTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-606s21c1
Sequence:CCGGATTGCTGGAGAGACGGTTATTCTCGAGAATAACCGTCTCTCCAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-1160s21c1
Sequence:CCGGCCCTTTGAAGTGCGTTAAGTTCTCGAGAACTTAACGCACTTCAAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-877s21c1
Sequence:CCGGTCCTTAGTAAAGTGTCTATTTCTCGAGAAATAGACACTTTACTAAGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-667s1c1
Sequence:CCGGCAAGGAGAAATGGATGTCTATCTCGAGATAGACATCCATTTCTCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-1161s1c1
Sequence:CCGGCCCTTTGAAGTGCGTTAAGTTCTCGAGAACTTAACGCACTTCAAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-770s1c1
Sequence:CCGGCCACTGTCAAAGCAAAGACAACTCGAGTTGTCTTTGCTTTGACAGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021880.1-464s1c1
Sequence:CCGGCCTCCTACGTTAGAAAGGTTACTCGAGTAACCTTTCTAACGTAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021880.2-1750s21c1
Sequence:CCGGGCCTGTAATTAAGCTAGTTTACTCGAGTAAACTAGCTTAATTACAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-274s1c1
Sequence:CCGGGCATTCCTTCGGGAATACTTTCTCGAGAAAGTATTCCCGAAGGAATGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021880
VALIDATED
PRKAR1A MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type I, alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274645    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-666s21c1
Sequence:CCGGCAAGGAGAAATGGATGTCTATCTCGAGATAGACATCCATTTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274646    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-606s21c1
Sequence:CCGGATTGCTGGAGAGACGGTTATTCTCGAGAATAACCGTCTCTCCAGCAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-1160s21c1
Sequence:CCGGCCCTTTGAAGTGCGTTAAGTTCTCGAGAACTTAACGCACTTCAAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274594    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_021880.2-877s21c1
Sequence:CCGGTCCTTAGTAAAGTGTCTATTTCTCGAGAAATAGACACTTTACTAAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-667s1c1
Sequence:CCGGCAAGGAGAAATGGATGTCTATCTCGAGATAGACATCCATTTCTCCTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-1161s1c1
Sequence:CCGGCCCTTTGAAGTGCGTTAAGTTCTCGAGAACTTAACGCACTTCAAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025486    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-770s1c1
Sequence:CCGGCCACTGTCAAAGCAAAGACAACTCGAGTTGTCTTTGCTTTGACAGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021880.1-464s1c1
Sequence:CCGGCCTCCTACGTTAGAAAGGTTACTCGAGTAACCTTTCTAACGTAGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021880.2-1750s21c1
Sequence:CCGGGCCTGTAATTAAGCTAGTTTACTCGAGTAAACTAGCTTAATTACAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025487    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021880.1-274s1c1
Sequence:CCGGGCATTCCTTCGGGAATACTTTCTCGAGAAAGTATTCCCGAAGGAATGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002734
VALIDATED
PRKAR1A MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type I, alpha
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002734.3-2622s1c1
Sequence:CCGGGCCTTATGTGTTACATTATTCCTCGAGGAATAATGTAACACATAAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-962s1c1
Sequence:CCGGCATTGGAACCAGTGCAGTTTGCTCGAGCAAACTGCACTGGTTCCAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-1135s1c1
Sequence:CCGGGCACTACTGATGAATCGTCCTCTCGAGAGGACGATTCATCAGTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-2567s1c1
Sequence:CCGGTATTCCAATGATACCCAACAGCTCGAGCTGTTGGGTATCATTGGAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-703s1c1
Sequence:CCGGGTCTATGTTAACAATGAATGGCTCGAGCCATTCATTGTTAACATAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-2183s1c1
Sequence:CCGGACTAGATACAGATGGAGCAACTCGAGTTGCTCCATCTGTATCTAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-816s1c1
Sequence:CCGGAAGATGTATGAGGAATTCCTCTCGAGAGGAATTCCTCATACATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-238s1c1
Sequence:CCGGGCGCTGCTCAAAGATTCTATTCTCGAGAATAGAATCTTTGAGCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-879s1c1
Sequence:CCGGGCGGAAGATGTATGAGGAATTCTCGAGAATTCCTCATACATCTTCCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000039938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-2211s1c1
Sequence:CCGGCCTCTGCTCATTAAACTGATTCTCGAGAATCAGTTTAATGAGCAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002734
VALIDATED
PRKAR1A MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type I, alpha
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002734.3-2622s1c1
Sequence:CCGGGCCTTATGTGTTACATTATTCCTCGAGGAATAATGTAACACATAAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-962s1c1
Sequence:CCGGCATTGGAACCAGTGCAGTTTGCTCGAGCAAACTGCACTGGTTCCAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-1135s1c1
Sequence:CCGGGCACTACTGATGAATCGTCCTCTCGAGAGGACGATTCATCAGTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-2567s1c1
Sequence:CCGGTATTCCAATGATACCCAACAGCTCGAGCTGTTGGGTATCATTGGAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-703s1c1
Sequence:CCGGGTCTATGTTAACAATGAATGGCTCGAGCCATTCATTGTTAACATAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-2183s1c1
Sequence:CCGGACTAGATACAGATGGAGCAACTCGAGTTGCTCCATCTGTATCTAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-816s1c1
Sequence:CCGGAAGATGTATGAGGAATTCCTCTCGAGAGGAATTCCTCATACATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-238s1c1
Sequence:CCGGGCGCTGCTCAAAGATTCTATTCTCGAGAATAGAATCTTTGAGCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-879s1c1
Sequence:CCGGGCGGAAGATGTATGAGGAATTCTCGAGAATTCCTCATACATCTTCCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-2211s1c1
Sequence:CCGGCCTCTGCTCATTAAACTGATTCTCGAGAATCAGTTTAATGAGCAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002734
VALIDATED
PRKAR1A MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type I, alpha
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196340    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002734.3-2622s1c1
Sequence:CCGGGCCTTATGTGTTACATTATTCCTCGAGGAATAATGTAACACATAAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-962s1c1
Sequence:CCGGCATTGGAACCAGTGCAGTTTGCTCGAGCAAACTGCACTGGTTCCAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-1135s1c1
Sequence:CCGGGCACTACTGATGAATCGTCCTCTCGAGAGGACGATTCATCAGTAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009885    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-2567s1c1
Sequence:CCGGTATTCCAATGATACCCAACAGCTCGAGCTGTTGGGTATCATTGGAATATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196434    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002734.3-703s1c1
Sequence:CCGGGTCTATGTTAACAATGAATGGCTCGAGCCATTCATTGTTAACATAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018369    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-2183s1c1
Sequence:CCGGACTAGATACAGATGGAGCAACTCGAGTTGCTCCATCTGTATCTAGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018368    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.x-816s1c1
Sequence:CCGGAAGATGTATGAGGAATTCCTCTCGAGAGGAATTCCTCATACATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039942    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-238s1c1
Sequence:CCGGGCGCTGCTCAAAGATTCTATTCTCGAGAATAGAATCTTTGAGCAGCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-879s1c1
Sequence:CCGGGCGGAAGATGTATGAGGAATTCTCGAGAATTCCTCATACATCTTCCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000039938    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002734.3-2211s1c1
Sequence:CCGGCCTCTGCTCATTAAACTGATTCTCGAGAATCAGTTTAATGAGCAGAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)