EMAIL THIS PAGE TO A FRIEND

PRKAR1B

protein kinase, cAMP-dependent, regulatory, type I, beta

56 Gene Product Result for
Synonyms: PRKAR1
UniProtKB ID: P31321, Q8N422
Gene ID:
Human(5575) Summary: Cyclic AMP-dependent protein kinase A (PKA) is an essential enzyme in the signaling pathway of the second messenger cAMP. Through phosphorylation of target proteins, PKA controls many biochemical events in the cell including regulation of metabolism, ion transport, and gene transcription. The PKA holoenzyme is composed of 2 regulatory and 2 catalytic subunits and dissociates from the regulatory subunits upon binding of cAMP.[supplied by OMIM, Jun 2009]
Mouse(19085) protein kinase, cAMP dependent regulatory, type I beta
Rat(25521) protein kinase, cAMP dependent regulatory, type I, beta
Zebrafish(767685) protein kinase, cAMP-dependent, regulatory, type I, beta
Horse(100054262) protein kinase, cAMP-dependent, regulatory, type I, beta
domestic cat(101085259) protein kinase, cAMP-dependent, regulatory, type I, beta
dog(480805) protein kinase, cAMP-dependent, regulatory, type I, beta
chicken(416446) protein kinase, cAMP-dependent, regulatory, type I, beta
domestic guinea pig(100713839) protein kinase, cAMP-dependent, regulatory, type I, beta
naked mole-rat(101700715) protein kinase, cAMP-dependent, regulatory, type I, beta
cow(505370) protein kinase, cAMP-dependent, regulatory, type I, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008923 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008923 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008923 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002735 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002735 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002735 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002735 Rosetta Predictions human pricing
NM_001033679 Rosetta Predictions rat pricing
NM_008923 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002735 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237915 predicted 615
2 SASI_Hs01_00237916 predicted 784
3 SASI_Hs01_00237917 predicted 620
4 SASI_Hs01_00237918 predicted 454
5 SASI_Hs01_00237919 predicted 446
6 SASI_Hs01_00237920 predicted 554
7 SASI_Hs01_00237921 predicted 821
8 SASI_Hs01_00237922 predicted 1203
9 SASI_Hs01_00237923 predicted 476
10 SASI_Hs01_00237924 predicted 1210
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033679 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098296 predicted 1260
2 SASI_Rn01_00098297 predicted 250
3 SASI_Rn01_00098298 predicted 446
4 SASI_Rn01_00098300 predicted 1130
5 SASI_Rn01_00098301 predicted 342
6 SASI_Rn01_00098302 predicted 1408
7 SASI_Rn01_00098303 predicted 381
8 SASI_Rn02_00203687 predicted 713
9 SASI_Rn01_00098304 predicted 740
10 SASI_Rn02_00203688 predicted 485
11 SASI_Rn01_00098295 predicted 537
12 SASI_Rn01_00098299 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008923 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137789 predicted 512
2 SASI_Mm01_00137790 predicted 418
3 SASI_Mm01_00137791 predicted 576
4 SASI_Mm01_00137792 predicted 551
5 SASI_Mm01_00137793 predicted 523
6 SASI_Mm02_00314955 predicted 576
7 SASI_Mm01_00137795 predicted 567
8 SASI_Mm01_00137796 predicted 501
9 SASI_Mm01_00137797 predicted 742
10 SASI_Mm01_00137798 predicted 992
11 SASI_Mm01_00137794 predicted 1378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008923
VALIDATED
PRKAR1B MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type I, beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008923.2-122s1c1
Sequence:CCGGTGCGAGATGTACGTGCAGAAACTCGAGTTTCTGCACGTACATCTCGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-1180s1c1
Sequence:CCGGCCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-931s1c1
Sequence:CCGGGCCTGGAGATGACTTCTACATCTCGAGATGTAGAAGTCATCTCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-787s1c1
Sequence:CCGGGCTGAGGAAACGCAAGATGTACTCGAGTACATCTTGCGTTTCCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-1180s21c1
Sequence:CCGGCCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008923.2-1637s21c1
Sequence:CCGGTGGTCTAGGCCCAAGTGTAAACTCGAGTTTACACTTGGGCCTAGACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-1023s21c1
Sequence:CCGGTTGGACCCTCTGACTACTTTGCTCGAGCAAAGTAGTCAGAGGGTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-405s21c1
Sequence:CCGGCCTACGTGAGGAAGGTCATTCCTCGAGGAATGACCTTCCTCACGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-605s21c1
Sequence:CCGGCAAGGAGAAGTAGATGTATATCTCGAGATATACATCTACTTCTCCTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008923
VALIDATED
PRKAR1B MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type I, beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008923.2-122s1c1
Sequence:CCGGTGCGAGATGTACGTGCAGAAACTCGAGTTTCTGCACGTACATCTCGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-1180s1c1
Sequence:CCGGCCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-931s1c1
Sequence:CCGGGCCTGGAGATGACTTCTACATCTCGAGATGTAGAAGTCATCTCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-787s1c1
Sequence:CCGGGCTGAGGAAACGCAAGATGTACTCGAGTACATCTTGCGTTTCCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-1180s21c1
Sequence:CCGGCCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008923.2-1637s21c1
Sequence:CCGGTGGTCTAGGCCCAAGTGTAAACTCGAGTTTACACTTGGGCCTAGACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-1023s21c1
Sequence:CCGGTTGGACCCTCTGACTACTTTGCTCGAGCAAAGTAGTCAGAGGGTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-405s21c1
Sequence:CCGGCCTACGTGAGGAAGGTCATTCCTCGAGGAATGACCTTCCTCACGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-605s21c1
Sequence:CCGGCAAGGAGAAGTAGATGTATATCTCGAGATATACATCTACTTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008923
VALIDATED
PRKAR1B MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type I, beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024753    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008923.2-122s1c1
Sequence:CCGGTGCGAGATGTACGTGCAGAAACTCGAGTTTCTGCACGTACATCTCGCATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-1180s1c1
Sequence:CCGGCCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-931s1c1
Sequence:CCGGGCCTGGAGATGACTTCTACATCTCGAGATGTAGAAGTCATCTCCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008923.2-787s1c1
Sequence:CCGGGCTGAGGAAACGCAAGATGTACTCGAGTACATCTTGCGTTTCCTCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-1180s21c1
Sequence:CCGGCCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008923.2-1637s21c1
Sequence:CCGGTGGTCTAGGCCCAAGTGTAAACTCGAGTTTACACTTGGGCCTAGACCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274597    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-1023s21c1
Sequence:CCGGTTGGACCCTCTGACTACTTTGCTCGAGCAAAGTAGTCAGAGGGTCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274649    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-405s21c1
Sequence:CCGGCCTACGTGAGGAAGGTCATTCCTCGAGGAATGACCTTCCTCACGTAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008923.2-605s21c1
Sequence:CCGGCAAGGAGAAGTAGATGTATATCTCGAGATATACATCTACTTCTCCTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002735
VALIDATED
PRKAR1B MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type I, beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000052563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-620s1c1
Sequence:CCGGGACAACTTCTATGTCGTTGATCTCGAGATCAACGACATAGAAGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002735.1-593s1c1
Sequence:CCGGACTGTTATACAGCAAGGGAATCTCGAGATTCCCTTGCTGTATAACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-1216s1c1
Sequence:CCGGTCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002735.1-1196s1c1
Sequence:CCGGGAGATCCTCAAGAGGAACATTCTCGAGAATGTTCCTCTTGAGGATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000052564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-544s1c1
Sequence:CCGGGAGTGACATATTCGATGCCATCTCGAGATGGCATCGAATATGTCACTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002735.1-1421s1c1
Sequence:CCGGCCTTGTGCATTTCCAAATCAACTCGAGTTGATTTGGAAATGCACAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-535s1c1
Sequence:CCGGCAACGAGAGGAGTGACATATTCTCGAGAATATGTCACTCCTCTCGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-157s1c1
Sequence:CCGGCTGTGAGCTGTACGTGCAGCTCTCGAGAGCTGCACGTACAGCTCACAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-1137s1c1
Sequence:CCGGCCCTCAAGTGTGTGAAGCTGGCTCGAGCCAGCTTCACACACTTGAGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002735
VALIDATED
PRKAR1B MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type I, beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000052563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-620s1c1
Sequence:CCGGGACAACTTCTATGTCGTTGATCTCGAGATCAACGACATAGAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002735.1-593s1c1
Sequence:CCGGACTGTTATACAGCAAGGGAATCTCGAGATTCCCTTGCTGTATAACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-1216s1c1
Sequence:CCGGTCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002735.1-1196s1c1
Sequence:CCGGGAGATCCTCAAGAGGAACATTCTCGAGAATGTTCCTCTTGAGGATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-544s1c1
Sequence:CCGGGAGTGACATATTCGATGCCATCTCGAGATGGCATCGAATATGTCACTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002735.1-1421s1c1
Sequence:CCGGCCTTGTGCATTTCCAAATCAACTCGAGTTGATTTGGAAATGCACAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-535s1c1
Sequence:CCGGCAACGAGAGGAGTGACATATTCTCGAGAATATGTCACTCCTCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-157s1c1
Sequence:CCGGCTGTGAGCTGTACGTGCAGCTCTCGAGAGCTGCACGTACAGCTCACAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-1137s1c1
Sequence:CCGGCCCTCAAGTGTGTGAAGCTGGCTCGAGCCAGCTTCACACACTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002735
VALIDATED
PRKAR1B MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type I, beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000052563    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-620s1c1
Sequence:CCGGGACAACTTCTATGTCGTTGATCTCGAGATCAACGACATAGAAGTTGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002735.1-593s1c1
Sequence:CCGGACTGTTATACAGCAAGGGAATCTCGAGATTCCCTTGCTGTATAACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-1216s1c1
Sequence:CCGGTCAGCGTTACAACAGCTTCATCTCGAGATGAAGCTGTTGTAACGCTGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002735.1-1196s1c1
Sequence:CCGGGAGATCCTCAAGAGGAACATTCTCGAGAATGTTCCTCTTGAGGATCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000052564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-544s1c1
Sequence:CCGGGAGTGACATATTCGATGCCATCTCGAGATGGCATCGAATATGTCACTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195143    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002735.1-1421s1c1
Sequence:CCGGCCTTGTGCATTTCCAAATCAACTCGAGTTGATTTGGAAATGCACAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-535s1c1
Sequence:CCGGCAACGAGAGGAGTGACATATTCTCGAGAATATGTCACTCCTCTCGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199098    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-157s1c1
Sequence:CCGGCTGTGAGCTGTACGTGCAGCTCTCGAGAGCTGCACGTACAGCTCACAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002735.1-1137s1c1
Sequence:CCGGCCCTCAAGTGTGTGAAGCTGGCTCGAGCCAGCTTCACACACTTGAGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)