EMAIL THIS PAGE TO A FRIEND

PRKAR2A

protein kinase, cAMP-dependent, regulatory, type II, alpha

163 Gene Product Result for
Synonyms: PKR2 PRKAR2
UniProtKB ID: P13861, Q16823
Gene ID:
Human(5576) Summary: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. It may interact with various A-kinase anchoring proteins and determine the subcellular localization of cAMP-dependent protein kinase. This subunit has been shown to regulate protein transport from endosomes to the Golgi apparatus and further to the endoplasmic reticulum (ER). [provided by RefSeq, Jul 2008]
Mouse(19087) protein kinase, cAMP dependent regulatory, type II alpha
Rat(29699) protein kinase, cAMP dependent regulatory, type II alpha
cow(100139910) protein kinase, cAMP-dependent, regulatory, type II, alpha
cow(518399) protein kinase, cAMP-dependent, regulatory, type II, alpha
sheep(101118483) protein kinase, cAMP-dependent, regulatory, type II, alpha
naked mole-rat(101706516) protein kinase, cAMP-dependent, regulatory, type II, alpha
domestic guinea pig(100728915) protein kinase, cAMP-dependent, regulatory, type II, alpha
dog(100685147) protein kinase, cAMP-dependent, regulatory, type II, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008924 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008924 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008924 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004157 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004157 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004157 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004157 siRNAs that have been validated in the lab human pricing
NM_019264 Rosetta Predictions rat pricing
NM_008924 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004157 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00122100 validated 1055
2 SASI_Hs02_00337012 predicted 1288
3 SASI_Hs01_00122102 predicted 1063
4 SASI_Hs02_00337013 predicted 1071
5 SASI_Hs01_00122103 predicted 547
6 SASI_Hs01_00122104 predicted 1173
7 SASI_Hs01_00122106 predicted 744
8 SASI_Hs01_00122108 predicted 551
9 SASI_Hs01_00122109 predicted 524
10 SASI_Hs02_00337014 predicted 856
11 SASI_Hs01_00122101 predicted 721
12 SASI_Hs01_00122105 predicted 634
13 SASI_Hs01_00122107 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019264 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262156 predicted 870
2 SASI_Rn01_00064069 predicted 392
3 SASI_Rn01_00064070 predicted 1262
4 SASI_Rn01_00064071 predicted 718
5 SASI_Rn01_00064072 predicted 540
6 SASI_Rn01_00064073 predicted 1310
7 SASI_Rn01_00064074 predicted 1237
8 SASI_Rn01_00064076 predicted 718
9 SASI_Rn01_00064078 predicted 894
10 SASI_Rn02_00262157 predicted 1073
11 SASI_Rn01_00064075 predicted 507
12 SASI_Rn01_00064077 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008924 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099948 predicted 700
2 SASI_Mm01_00099949 predicted 1370
3 SASI_Mm01_00099950 predicted 1516
4 SASI_Mm01_00099951 predicted 1279
5 SASI_Mm01_00099952 predicted 1092
6 SASI_Mm01_00099954 predicted 865
7 SASI_Mm01_00099955 predicted 923
8 SASI_Mm02_00314956 predicted 1276
9 SASI_Mm01_00099956 predicted 608
10 SASI_Mm01_00099957 predicted 1372
11 SASI_Mm01_00099953 predicted 1450
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008924
VALIDATED
PRKAR2A MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type II, alpha
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000345177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-449s21c1
Sequence:CCGGCCAGGAATCAGACACGTTCATCTCGAGATGAACGTGTCTGATTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-874s21c1
Sequence:CCGGCGAAAGATAATCAAACACGTTCTCGAGAACGTGTTTGATTATCTTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-1191s21c1
Sequence:CCGGGCCGACAGCTTCTATATCATACTCGAGTATGATATAGAAGCTGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-1372s21c1
Sequence:CCGGGAGATGTCAAATGCTTAGTTACTCGAGTAACTAAGCATTTGACATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-1191s1c1
Sequence:CCGGGCCGACAGCTTCTATATCATACTCGAGTATGATATAGAAGCTGTCGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-874s1c1
Sequence:CCGGCGAAAGATAATCAAACACGTTCTCGAGAACGTGTTTGATTATCTTTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-1372s1c1
Sequence:CCGGGAGATGTCAAATGCTTAGTTACTCGAGTAACTAAGCATTTGACATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-449s1c1
Sequence:CCGGCCAGGAATCAGACACGTTCATCTCGAGATGAACGTGTCTGATTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-583s1c1
Sequence:CCGGGCAAATTTACTAGACGAGTATCTCGAGATACTCGTCTAGTAAATTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008924
VALIDATED
PRKAR2A MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type II, alpha
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000345177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-449s21c1
Sequence:CCGGCCAGGAATCAGACACGTTCATCTCGAGATGAACGTGTCTGATTCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-874s21c1
Sequence:CCGGCGAAAGATAATCAAACACGTTCTCGAGAACGTGTTTGATTATCTTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-1191s21c1
Sequence:CCGGGCCGACAGCTTCTATATCATACTCGAGTATGATATAGAAGCTGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000345125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-1372s21c1
Sequence:CCGGGAGATGTCAAATGCTTAGTTACTCGAGTAACTAAGCATTTGACATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-1191s1c1
Sequence:CCGGGCCGACAGCTTCTATATCATACTCGAGTATGATATAGAAGCTGTCGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-874s1c1
Sequence:CCGGCGAAAGATAATCAAACACGTTCTCGAGAACGTGTTTGATTATCTTTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-1372s1c1
Sequence:CCGGGAGATGTCAAATGCTTAGTTACTCGAGTAACTAAGCATTTGACATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-449s1c1
Sequence:CCGGCCAGGAATCAGACACGTTCATCTCGAGATGAACGTGTCTGATTCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-583s1c1
Sequence:CCGGGCAAATTTACTAGACGAGTATCTCGAGATACTCGTCTAGTAAATTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008924
VALIDATED
PRKAR2A MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type II, alpha
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000345177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-449s21c1
Sequence:CCGGCCAGGAATCAGACACGTTCATCTCGAGATGAACGTGTCTGATTCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-874s21c1
Sequence:CCGGCGAAAGATAATCAAACACGTTCTCGAGAACGTGTTTGATTATCTTTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-1191s21c1
Sequence:CCGGGCCGACAGCTTCTATATCATACTCGAGTATGATATAGAAGCTGTCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000345125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008924.2-1372s21c1
Sequence:CCGGGAGATGTCAAATGCTTAGTTACTCGAGTAACTAAGCATTTGACATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-1191s1c1
Sequence:CCGGGCCGACAGCTTCTATATCATACTCGAGTATGATATAGAAGCTGTCGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-874s1c1
Sequence:CCGGCGAAAGATAATCAAACACGTTCTCGAGAACGTGTTTGATTATCTTTCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-1372s1c1
Sequence:CCGGGAGATGTCAAATGCTTAGTTACTCGAGTAACTAAGCATTTGACATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-449s1c1
Sequence:CCGGCCAGGAATCAGACACGTTCATCTCGAGATGAACGTGTCTGATTCCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008924.1-583s1c1
Sequence:CCGGGCAAATTTACTAGACGAGTATCTCGAGATACTCGTCTAGTAAATTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004157
VALIDATED
PRKAR2A MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type II, alpha
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-545s21c1
Sequence:CCGGGCTGAGACCTATAACCCTGATCTCGAGATCAGGGTTATAGGTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.2-823s1c1
Sequence:CCGGCCGCTCTGTTGGTCAATATGACTCGAGTCATATTGACCAACAGAGCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-710s21c1
Sequence:CCGGGAAAGGATAGTCAAAGCTGATCTCGAGATCAGCTTTGACTATCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1164s21c1
Sequence:CCGGTCTTGATTAGAAGCAGGACTACTCGAGTAGTCCTGCTTCTAATCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-464s1c1
Sequence:CCGGGCAGATTTAATAGACGAGTATCTCGAGATACTCGTCTATTAAATCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.1-1112s1c1
Sequence:CCGGTCTTGATTAGAAGCAGGACTACTCGAGTAGTCCTGCTTCTAATCAAGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-493s1c1
Sequence:CCGGGCTGAGACCTATAACCCTGATCTCGAGATCAGGGTTATAGGTCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-1049s1c1
Sequence:CCGGGCATAATCACTCAGGGTGAAACTCGAGTTTCACCCTGAGTGATTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1574s21c1
Sequence:GTACCGGTTGCTGTGGTTATGGGCATTTCTCGAGAAATGCCCATAACCACAGCAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1101s21c1
Sequence:CCGGGCATAATCACTCAGGGTGAAACTCGAGTTTCACCCTGAGTGATTATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.1-658s1c1
Sequence:CCGGGAAAGGATAGTCAAAGCTGATCTCGAGATCAGCTTTGACTATCCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004157
VALIDATED
PRKAR2A MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type II, alpha
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-545s21c1
Sequence:CCGGGCTGAGACCTATAACCCTGATCTCGAGATCAGGGTTATAGGTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.2-823s1c1
Sequence:CCGGCCGCTCTGTTGGTCAATATGACTCGAGTCATATTGACCAACAGAGCGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-710s21c1
Sequence:CCGGGAAAGGATAGTCAAAGCTGATCTCGAGATCAGCTTTGACTATCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1164s21c1
Sequence:CCGGTCTTGATTAGAAGCAGGACTACTCGAGTAGTCCTGCTTCTAATCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-464s1c1
Sequence:CCGGGCAGATTTAATAGACGAGTATCTCGAGATACTCGTCTATTAAATCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.1-1112s1c1
Sequence:CCGGTCTTGATTAGAAGCAGGACTACTCGAGTAGTCCTGCTTCTAATCAAGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-493s1c1
Sequence:CCGGGCTGAGACCTATAACCCTGATCTCGAGATCAGGGTTATAGGTCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-1049s1c1
Sequence:CCGGGCATAATCACTCAGGGTGAAACTCGAGTTTCACCCTGAGTGATTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1574s21c1
Sequence:GTACCGGTTGCTGTGGTTATGGGCATTTCTCGAGAAATGCCCATAACCACAGCAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1101s21c1
Sequence:CCGGGCATAATCACTCAGGGTGAAACTCGAGTTTCACCCTGAGTGATTATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.1-658s1c1
Sequence:CCGGGAAAGGATAGTCAAAGCTGATCTCGAGATCAGCTTTGACTATCCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004157
VALIDATED
PRKAR2A MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type II, alpha
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-545s21c1
Sequence:CCGGGCTGAGACCTATAACCCTGATCTCGAGATCAGGGTTATAGGTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.2-823s1c1
Sequence:CCGGCCGCTCTGTTGGTCAATATGACTCGAGTCATATTGACCAACAGAGCGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-710s21c1
Sequence:CCGGGAAAGGATAGTCAAAGCTGATCTCGAGATCAGCTTTGACTATCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1164s21c1
Sequence:CCGGTCTTGATTAGAAGCAGGACTACTCGAGTAGTCCTGCTTCTAATCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037804    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-464s1c1
Sequence:CCGGGCAGATTTAATAGACGAGTATCTCGAGATACTCGTCTATTAAATCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.1-1112s1c1
Sequence:CCGGTCTTGATTAGAAGCAGGACTACTCGAGTAGTCCTGCTTCTAATCAAGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-493s1c1
Sequence:CCGGGCTGAGACCTATAACCCTGATCTCGAGATCAGGGTTATAGGTCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004157.1-1049s1c1
Sequence:CCGGGCATAATCACTCAGGGTGAAACTCGAGTTTCACCCTGAGTGATTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380969    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1574s21c1
Sequence:GTACCGGTTGCTGTGGTTATGGGCATTTCTCGAGAAATGCCCATAACCACAGCAATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_004157.2-1101s21c1
Sequence:CCGGGCATAATCACTCAGGGTGAAACTCGAGTTTCACCCTGAGTGATTATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004157.1-658s1c1
Sequence:CCGGGAAAGGATAGTCAAAGCTGATCTCGAGATCAGCTTTGACTATCCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)