EMAIL THIS PAGE TO A FRIEND

PRKAR2B

protein kinase, cAMP-dependent, regulatory, type II, beta

94 Gene Product Result for
Synonyms: PRKAR2 RII-BETA
UniProtKB ID: P31323, A4D0R9
Gene ID:
Human(5577) Summary: cAMP is a signaling molecule important for a variety of cellular functions. cAMP exerts its effects by activating the cAMP-dependent protein kinase, which transduces the signal through phosphorylation of different target proteins. The inactive kinase holoenzyme is a tetramer composed of two regulatory and two catalytic subunits. cAMP causes the dissociation of the inactive holoenzyme into a dimer of regulatory subunits bound to four cAMP and two free monomeric catalytic subunits. Four different regulatory subunits and three catalytic subunits have been identified in humans. The protein encoded by this gene is one of the regulatory subunits. This subunit can be phosphorylated by the activated catalytic subunit. This subunit has been shown to interact with and suppress the transcriptional activity of the cAMP responsive element binding protein 1 (CREB1) in activated T cells. Knockout studies in mice suggest that this subunit may play an important role in regulating energy balance and adiposity. The studies also suggest that this subunit may mediate the gene induction and cataleptic behavior induced by haloperidol. [provided by RefSeq, Jul 2008]
Mouse(19088) protein kinase, cAMP dependent regulatory, type II beta
Rat(24679) protein kinase, cAMP dependent regulatory, type II beta
chicken(769420) protein kinase, cAMP-dependent, regulatory, type II, beta
domestic cat(101081127) protein kinase, cAMP-dependent, regulatory, type II, beta
dog(475887) protein kinase, cAMP-dependent, regulatory, type II, beta
domestic guinea pig(100719506) protein kinase, cAMP-dependent, regulatory, type II, beta
naked mole-rat(101706694) protein kinase, cAMP-dependent, regulatory, type II, beta
cow(282463) protein kinase, cAMP-dependent, regulatory, type II, beta
sheep(100500720) protein kinase, cAMP-dependent, regulatory, type II, beta
sheep(101106003) protein kinase, cAMP-dependent, regulatory, type II, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002736 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011158 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011158 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011158 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002736 Rosetta Predictions human pricing
NM_001030020 Rosetta Predictions rat pricing
NM_011158 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015867 predicted 1089
2 SASI_Hs01_00015869 predicted 510
3 SASI_Hs01_00015870 predicted 471
4 SASI_Hs02_00334341 predicted 611
5 SASI_Hs01_00015871 predicted 604
6 SASI_Hs01_00015872 predicted 1149
7 SASI_Hs01_00015873 predicted 1170
8 SASI_Hs01_00015874 predicted 1041
9 SASI_Hs01_00015875 predicted 1294
10 SASI_Hs02_00334342 predicted 1030
11 SASI_Hs01_00015868 predicted 927
12 SASI_Hs01_00015876 predicted 909
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203515 predicted 475
2 SASI_Rn02_00203516 predicted 290
3 SASI_Rn02_00203517 predicted 1220
4 SASI_Rn02_00203518 predicted 537
5 SASI_Rn02_00203519 predicted 865
6 SASI_Rn02_00203520 predicted 618
7 SASI_Rn02_00203521 predicted 981
8 SASI_Rn02_00203522 predicted 1314
9 SASI_Rn02_00203523 predicted 337
10 SASI_Rn02_00203524 predicted 1192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011158 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320018 predicted 1017
2 SASI_Mm01_00163961 predicted 1461
3 SASI_Mm01_00163962 predicted 485
4 SASI_Mm01_00163963 predicted 1061
5 SASI_Mm02_00320019 predicted 540
6 SASI_Mm01_00163965 predicted 1462
7 SASI_Mm02_00320020 predicted 631
8 SASI_Mm01_00163967 predicted 759
9 SASI_Mm01_00163968 predicted 808
10 SASI_Mm01_00163969 predicted 1505
11 SASI_Mm01_00163964 predicted 1172
12 SASI_Mm01_00163966 predicted 610
13 SASI_Mm01_00163970 predicted 1096
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002736
VALIDATED
PRKAR2B MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type II, beta
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-556s1c1
Sequence:CCGGGTCCAGGATTATACATCCAAACTCGAGTTTGGATGTATAATCCTGGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002736.2-518s1c1
Sequence:CCGGGTATGTGCAGAAGCTTATAATCTCGAGATTATAAGCTTCTGCACATACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-1021s1c1
Sequence:CCGGCCTGAAAGTAGTAGATGTGATCTCGAGATCACATCTACTACTTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-612s1c1
Sequence:CCGGGCAAAGACATCCTGCTGTTTACTCGAGTAAACAGCAGGATGTCTTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-659s1c1
Sequence:CCGGCAAGTATTAGATGCCATGTTTCTCGAGAAACATGGCATCTAATACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-558s21c1
Sequence:CCGGATGCAGAGTCCAGGATTATACCTCGAGGTATAATCCTGGACTCTGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.2-482s1c1
Sequence:CCGGGCTCCAGTAATAAACCGATTCCTCGAGGAATCGGTTTATTACTGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002736.2-1585s21c1
Sequence:GTACCGGTAATAGTCAATAGGCTTTAACCTCGAGGTTAAAGCCTATTGACTATTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002736.2-1401s1c1
Sequence:CCGGCGAACATGGATATTGTTGAACCTCGAGGTTCAACAATATCCATGTTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002736.2-1745s1c1
Sequence:CCGGGATGTTATCATAGGCTATATGCTCGAGCATATAGCCTATGATAACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.2-474s1c1
Sequence:CCGGCGTTCAATGCTCCAGTAATAACTCGAGTTATTACTGGAGCATTGAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-656s21c1
Sequence:CCGGGAGCAGATGTCTCAAGTATTACTCGAGTAATACTTGAGACATCTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000330005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-1401s21c1
Sequence:CCGGCGAACATGGATATTGTTGAACCTCGAGGTTCAACAATATCCATGTTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-518s21c1
Sequence:CCGGGTATGTGCAGAAGCTTATAATCTCGAGATTATAAGCTTCTGCACATACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000353640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-1815s21c1
Sequence:CCGGAGAGGGCACTTGGCAATTAAACTCGAGTTTAATTGCCAAGTGCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-472s21c1
Sequence:GTACCGGGGCGTTCAATGCTCCAGTAATCTCGAGATTACTGGAGCATTGAACGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002736
VALIDATED
PRKAR2B MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type II, beta
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-556s1c1
Sequence:CCGGGTCCAGGATTATACATCCAAACTCGAGTTTGGATGTATAATCCTGGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002736.2-518s1c1
Sequence:CCGGGTATGTGCAGAAGCTTATAATCTCGAGATTATAAGCTTCTGCACATACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-1021s1c1
Sequence:CCGGCCTGAAAGTAGTAGATGTGATCTCGAGATCACATCTACTACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-612s1c1
Sequence:CCGGGCAAAGACATCCTGCTGTTTACTCGAGTAAACAGCAGGATGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-659s1c1
Sequence:CCGGCAAGTATTAGATGCCATGTTTCTCGAGAAACATGGCATCTAATACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-558s21c1
Sequence:CCGGATGCAGAGTCCAGGATTATACCTCGAGGTATAATCCTGGACTCTGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.2-482s1c1
Sequence:CCGGGCTCCAGTAATAAACCGATTCCTCGAGGAATCGGTTTATTACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002736.2-1585s21c1
Sequence:GTACCGGTAATAGTCAATAGGCTTTAACCTCGAGGTTAAAGCCTATTGACTATTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002736.2-1401s1c1
Sequence:CCGGCGAACATGGATATTGTTGAACCTCGAGGTTCAACAATATCCATGTTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002736.2-1745s1c1
Sequence:CCGGGATGTTATCATAGGCTATATGCTCGAGCATATAGCCTATGATAACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.2-474s1c1
Sequence:CCGGCGTTCAATGCTCCAGTAATAACTCGAGTTATTACTGGAGCATTGAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-656s21c1
Sequence:CCGGGAGCAGATGTCTCAAGTATTACTCGAGTAATACTTGAGACATCTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-1401s21c1
Sequence:CCGGCGAACATGGATATTGTTGAACCTCGAGGTTCAACAATATCCATGTTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-518s21c1
Sequence:CCGGGTATGTGCAGAAGCTTATAATCTCGAGATTATAAGCTTCTGCACATACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-1815s21c1
Sequence:CCGGAGAGGGCACTTGGCAATTAAACTCGAGTTTAATTGCCAAGTGCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-472s21c1
Sequence:GTACCGGGGCGTTCAATGCTCCAGTAATCTCGAGATTACTGGAGCATTGAACGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002736
VALIDATED
PRKAR2B MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type II, beta
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-556s1c1
Sequence:CCGGGTCCAGGATTATACATCCAAACTCGAGTTTGGATGTATAATCCTGGACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196892    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002736.2-518s1c1
Sequence:CCGGGTATGTGCAGAAGCTTATAATCTCGAGATTATAAGCTTCTGCACATACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037815    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-1021s1c1
Sequence:CCGGCCTGAAAGTAGTAGATGTGATCTCGAGATCACATCTACTACTTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-612s1c1
Sequence:CCGGGCAAAGACATCCTGCTGTTTACTCGAGTAAACAGCAGGATGTCTTTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.1-659s1c1
Sequence:CCGGCAAGTATTAGATGCCATGTTTCTCGAGAAACATGGCATCTAATACTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-558s21c1
Sequence:CCGGATGCAGAGTCCAGGATTATACCTCGAGGTATAATCCTGGACTCTGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.2-482s1c1
Sequence:CCGGGCTCCAGTAATAAACCGATTCCTCGAGGAATCGGTTTATTACTGGAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002736.2-1585s21c1
Sequence:GTACCGGTAATAGTCAATAGGCTTTAACCTCGAGGTTAAAGCCTATTGACTATTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002736.2-1401s1c1
Sequence:CCGGCGAACATGGATATTGTTGAACCTCGAGGTTCAACAATATCCATGTTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002736.2-1745s1c1
Sequence:CCGGGATGTTATCATAGGCTATATGCTCGAGCATATAGCCTATGATAACATCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002736.2-474s1c1
Sequence:CCGGCGTTCAATGCTCCAGTAATAACTCGAGTTATTACTGGAGCATTGAACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330007    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-656s21c1
Sequence:CCGGGAGCAGATGTCTCAAGTATTACTCGAGTAATACTTGAGACATCTGCTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000330005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-1401s21c1
Sequence:CCGGCGAACATGGATATTGTTGAACCTCGAGGTTCAACAATATCCATGTTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353586    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002736.2-518s21c1
Sequence:CCGGGTATGTGCAGAAGCTTATAATCTCGAGATTATAAGCTTCTGCACATACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000353640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-1815s21c1
Sequence:CCGGAGAGGGCACTTGGCAATTAAACTCGAGTTTAATTGCCAAGTGCCCTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380090    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_002736.2-472s21c1
Sequence:GTACCGGGGCGTTCAATGCTCCAGTAATCTCGAGATTACTGGAGCATTGAACGCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011158
PRKAR2B MISSION shRNA Bacterial Glycerol Stock
protein kinase, cAMP-dependent, regulatory, type II, beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-1353s1c1
Sequence:CCGGCGCCACCTATGAAGAACAATTCTCGAGAATTGTTCTTCATAGGTGGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-741s1c1
Sequence:CCGGCGTCATTGACAGAGGAACATTCTCGAGAATGTTCCTCTGTCAATGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-917s1c1
Sequence:CCGGCCTTCAGGAGAATAATTGTAACTCGAGTTACAATTATTCTCCTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-471s1c1
Sequence:CCGGCGCTCCAGTTATAAACCGGTTCTCGAGAACCGGTTTATAACTGGAGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000025471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-546s1c1
Sequence:CCGGCGATGCAGAGTCCAGGATAATCTCGAGATTATCCTGGACTCTGCATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011158.3-1860s21c1
Sequence:CCGGATGCGCTCTAACGTGGTATTCCTCGAGGAATACCACGTTAGAGCGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011158.3-1411s21c1
Sequence:CCGGTTGGAACAAACATGGATATTGCTCGAGCAATATCCATGTTTGTTCCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011158.3-490s21c1
Sequence:CCGGCGTTCAACGCTCCAGTTATAACTCGAGTTATAACTGGAGCGTTGAACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011158
PRKAR2B MISSION shRNA shRNA Plasmid DNA
protein kinase, cAMP-dependent, regulatory, type II, beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-1353s1c1
Sequence:CCGGCGCCACCTATGAAGAACAATTCTCGAGAATTGTTCTTCATAGGTGGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-741s1c1
Sequence:CCGGCGTCATTGACAGAGGAACATTCTCGAGAATGTTCCTCTGTCAATGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-917s1c1
Sequence:CCGGCCTTCAGGAGAATAATTGTAACTCGAGTTACAATTATTCTCCTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-471s1c1
Sequence:CCGGCGCTCCAGTTATAAACCGGTTCTCGAGAACCGGTTTATAACTGGAGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-546s1c1
Sequence:CCGGCGATGCAGAGTCCAGGATAATCTCGAGATTATCCTGGACTCTGCATCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011158.3-1860s21c1
Sequence:CCGGATGCGCTCTAACGTGGTATTCCTCGAGGAATACCACGTTAGAGCGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011158.3-1411s21c1
Sequence:CCGGTTGGAACAAACATGGATATTGCTCGAGCAATATCCATGTTTGTTCCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011158.3-490s21c1
Sequence:CCGGCGTTCAACGCTCCAGTTATAACTCGAGTTATAACTGGAGCGTTGAACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011158
PRKAR2B MISSION shRNA Lentiviral Transduction Particles
protein kinase, cAMP-dependent, regulatory, type II, beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-1353s1c1
Sequence:CCGGCGCCACCTATGAAGAACAATTCTCGAGAATTGTTCTTCATAGGTGGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025470    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-741s1c1
Sequence:CCGGCGTCATTGACAGAGGAACATTCTCGAGAATGTTCCTCTGTCAATGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-917s1c1
Sequence:CCGGCCTTCAGGAGAATAATTGTAACTCGAGTTACAATTATTCTCCTGAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025473    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-471s1c1
Sequence:CCGGCGCTCCAGTTATAAACCGGTTCTCGAGAACCGGTTTATAACTGGAGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000025471    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011158.2-546s1c1
Sequence:CCGGCGATGCAGAGTCCAGGATAATCTCGAGATTATCCTGGACTCTGCATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360700    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011158.3-1860s21c1
Sequence:CCGGATGCGCTCTAACGTGGTATTCCTCGAGGAATACCACGTTAGAGCGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011158.3-1411s21c1
Sequence:CCGGTTGGAACAAACATGGATATTGCTCGAGCAATATCCATGTTTGTTCCAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011158.3-490s21c1
Sequence:CCGGCGTTCAACGCTCCAGTTATAACTCGAGTTATAACTGGAGCGTTGAACGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)