EMAIL THIS PAGE TO A FRIEND

PRKCA

protein kinase C, alpha

215 Gene Product Result for
Synonyms: AAG6 PKC-alpha PKCA PRKACA
UniProtKB ID: P17252, B5BU22, Q15137, Q32M72, Q96RE4
Gene ID:
Human(5578) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been reported to play roles in many different cellular processes, such as cell adhesion, cell transformation, cell cycle checkpoint, and cell volume control. Knockout studies in mice suggest that this kinase may be a fundamental regulator of cardiac contractility and Ca(2+) handling in myocytes. [provided by RefSeq, Jul 2008]
Mouse(18750) protein kinase C, alpha
Rat(24680) protein kinase C, alpha
cow(282001) protein kinase C, alpha
sheep(101110074) protein kinase C, alpha
naked mole-rat(101716044) protein kinase C, alpha
Domestic Rabbit(100037720) protein kinase C, alpha
domestic guinea pig(100302324) protein kinase C, alpha
domestic guinea pig(100713627) protein kinase C, alpha
Zebrafish(497384) protein kinase C, alpha
domestic cat(101086433) protein kinase C, alpha
Horse(100063318) protein kinase C, alpha
dog(490904) protein kinase C, alpha
chicken(417430) protein kinase C, alpha
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504057 Anti-phospho-PKC α (pThr638) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4301254 Anti-phospho-PKC α (pTyr657) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504096 Anti-phospho-PKC α (pTyr658) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4504099 Anti-phospho-PKC-pan (pThr497) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502354 Anti-PKC α antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4502355 Anti-PKC α antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4502356 Anti-PKC-PAN antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA006563 Anti-PKCA antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA006564 Anti-PKCA antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4502357 Anti-PRKCA antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry pricing
P4334 Anti-Protein Kinase Cα antibody produced in rabbit whole antiserum rat, mouse
microarray, western blot pricing
WH0005578M1 Monoclonal Anti-PRKCA antibody produced in mouse clone 2F11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011101 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011101 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011101 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002737 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002737 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002737 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002737 siRNAs that have been validated in the lab human pricing
NM_001105713 Rosetta Predictions rat pricing
NM_011101 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002737 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018816 validated 826
1 SASI_Hs01_00018815 validated 1324
1 SASI_Hs01_00018817 validated 1125
2 SASI_Hs01_00018818 predicted 1883
3 SASI_Hs01_00018819 predicted 1022
4 SASI_Hs01_00018820 predicted 2040
5 SASI_Hs01_00018821 predicted 707
6 SASI_Hs01_00018822 predicted 739
7 SASI_Hs02_00334343 predicted 693
8 SASI_Hs01_00018824 predicted 522
9 SASI_Hs02_00334344 predicted 1151
10 SASI_Hs01_00018823 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211796 predicted 561
2 SASI_Rn02_00211797 predicted 638
3 SASI_Rn02_00211798 predicted 1787
4 SASI_Rn02_00211799 predicted 1854
5 SASI_Rn02_00211800 predicted 1096
6 SASI_Rn02_00211801 predicted 1258
7 SASI_Rn02_00211802 predicted 2154
8 SASI_Rn02_00211803 predicted 928
9 SASI_Rn02_00211804 predicted 2089
10 SASI_Rn02_00211805 predicted 913
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011101 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162578 predicted 2219
2 SASI_Mm02_00319892 predicted 1036
3 SASI_Mm01_00162581 predicted 1195
4 SASI_Mm01_00162582 predicted 1747
5 SASI_Mm01_00162585 predicted 588
6 SASI_Mm02_00319893 predicted 794
7 SASI_Mm02_00319894 predicted 923
8 SASI_Mm01_00162577 predicted 1053
9 SASI_Mm02_00319895 predicted 1453
10 SASI_Mm02_00319896 predicted 887
11 SASI_Mm01_00162579 predicted 2087
12 SASI_Mm01_00162580 predicted 1980
13 SASI_Mm01_00162583 predicted 1661
14 SASI_Mm01_00162584 predicted 1650
15 SASI_Mm01_00162586 predicted 1178
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011101
VALIDATED
PRKCA MISSION shRNA Bacterial Glycerol Stock
protein kinase C, alpha
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-932s21c1
Sequence:CCGGCCGGCGACTGTCTGTAGAAATCTCGAGATTTCTACAGACAGTCGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000218783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1569s21c1
Sequence:GTACCGGGGACTGTTCTTCCTTCATAAACTCGAGTTTATGAAGGAAGAACAGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-5141s21c1
Sequence:CCGGATACACTGCTGAGGGTTAAATCTCGAGATTTAACCCTCAGCAGTGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-2428s21c1
Sequence:CCGGCTTAGTGGATGATGACATAAACTCGAGTTTATGTCATCATCCACTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-2146s21c1
Sequence:CCGGAGCTGGTCATTGCTAACATAGCTCGAGCTATGTTAGCAATGACCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-2594s21c1
Sequence:CCGGGAATCGACCAGAGATAGTAAACTCGAGTTTACTATCTCTGGTCGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1029s21c1
Sequence:CCGGCCGGCCAGTGGATGGTATAAACTCGAGTTTATACCATCCACTGGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-1055s21c1
Sequence:CCGGCAACCAAGAAGAGGGCGAATACTCGAGTATTCGCCCTCTTCTTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-835s1c1
Sequence:CCGGCCTTATGTGAAGCTGAAACTACTCGAGTAGTTTCAGCTTCACATAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-2086s1c1
Sequence:CCGGCAACCACCATTCAAGCCCAAACTCGAGTTTGGGCTTGAATGGTGGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-2191s1c1
Sequence:CCGGGCTAACATAGACCAATCTGATCTCGAGATCAGATTGGTCTATGTTAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-1602s1c1
Sequence:CCGGCGGACTGTTCTTCCTTCATAACTCGAGTTATGAAGGAAGAACAGTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1505s21c1
Sequence:CCGGCATTCAGCAAGTCGGGAAATTCTCGAGAATTTCCCGACTTGCTGAATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000235973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-892s21c1
Sequence:CCGGATGAGTCCTTCACGTTCAAATCTCGAGATTTGAACGTGAAGGACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011101
VALIDATED
PRKCA MISSION shRNA shRNA Plasmid DNA
protein kinase C, alpha
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-932s21c1
Sequence:CCGGCCGGCGACTGTCTGTAGAAATCTCGAGATTTCTACAGACAGTCGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1569s21c1
Sequence:GTACCGGGGACTGTTCTTCCTTCATAAACTCGAGTTTATGAAGGAAGAACAGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-5141s21c1
Sequence:CCGGATACACTGCTGAGGGTTAAATCTCGAGATTTAACCCTCAGCAGTGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-2428s21c1
Sequence:CCGGCTTAGTGGATGATGACATAAACTCGAGTTTATGTCATCATCCACTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-2146s21c1
Sequence:CCGGAGCTGGTCATTGCTAACATAGCTCGAGCTATGTTAGCAATGACCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-2594s21c1
Sequence:CCGGGAATCGACCAGAGATAGTAAACTCGAGTTTACTATCTCTGGTCGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1029s21c1
Sequence:CCGGCCGGCCAGTGGATGGTATAAACTCGAGTTTATACCATCCACTGGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-1055s21c1
Sequence:CCGGCAACCAAGAAGAGGGCGAATACTCGAGTATTCGCCCTCTTCTTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-835s1c1
Sequence:CCGGCCTTATGTGAAGCTGAAACTACTCGAGTAGTTTCAGCTTCACATAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-2086s1c1
Sequence:CCGGCAACCACCATTCAAGCCCAAACTCGAGTTTGGGCTTGAATGGTGGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-2191s1c1
Sequence:CCGGGCTAACATAGACCAATCTGATCTCGAGATCAGATTGGTCTATGTTAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-1602s1c1
Sequence:CCGGCGGACTGTTCTTCCTTCATAACTCGAGTTATGAAGGAAGAACAGTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1505s21c1
Sequence:CCGGCATTCAGCAAGTCGGGAAATTCTCGAGAATTTCCCGACTTGCTGAATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-892s21c1
Sequence:CCGGATGAGTCCTTCACGTTCAAATCTCGAGATTTGAACGTGAAGGACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011101
VALIDATED
PRKCA MISSION shRNA Lentiviral Transduction Particles
protein kinase C, alpha
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361430    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-932s21c1
Sequence:CCGGCCGGCGACTGTCTGTAGAAATCTCGAGATTTCTACAGACAGTCGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000218783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1569s21c1
Sequence:GTACCGGGGACTGTTCTTCCTTCATAAACTCGAGTTTATGAAGGAAGAACAGTCCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235976    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-5141s21c1
Sequence:CCGGATACACTGCTGAGGGTTAAATCTCGAGATTTAACCCTCAGCAGTGTATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361364    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-2428s21c1
Sequence:CCGGCTTAGTGGATGATGACATAAACTCGAGTTTATGTCATCATCCACTAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-2146s21c1
Sequence:CCGGAGCTGGTCATTGCTAACATAGCTCGAGCTATGTTAGCAATGACCAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011101.3-2594s21c1
Sequence:CCGGGAATCGACCAGAGATAGTAAACTCGAGTTTACTATCTCTGGTCGATTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1029s21c1
Sequence:CCGGCCGGCCAGTGGATGGTATAAACTCGAGTTTATACCATCCACTGGCCGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-1055s21c1
Sequence:CCGGCAACCAAGAAGAGGGCGAATACTCGAGTATTCGCCCTCTTCTTGGTTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-835s1c1
Sequence:CCGGCCTTATGTGAAGCTGAAACTACTCGAGTAGTTTCAGCTTCACATAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-2086s1c1
Sequence:CCGGCAACCACCATTCAAGCCCAAACTCGAGTTTGGGCTTGAATGGTGGTTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-2191s1c1
Sequence:CCGGGCTAACATAGACCAATCTGATCTCGAGATCAGATTGGTCTATGTTAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011101.1-1602s1c1
Sequence:CCGGCGGACTGTTCTTCCTTCATAACTCGAGTTATGAAGGAAGAACAGTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011101.3-1505s21c1
Sequence:CCGGCATTCAGCAAGTCGGGAAATTCTCGAGAATTTCCCGACTTGCTGAATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000235973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011101.3-892s21c1
Sequence:CCGGATGAGTCCTTCACGTTCAAATCTCGAGATTTGAACGTGAAGGACTCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002737
PRKCA MISSION shRNA Bacterial Glycerol Stock
protein kinase C, alpha
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.2-7472s1c1
Sequence:CCGGCTGAATATACTGGGCTATTTGCTCGAGCAAATAGCCCAGTATATTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.2-3403s1c1
Sequence:CCGGGACACAATTGTGCTCTATTTGCTCGAGCAAATAGAGCACAATTGTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002737.2-6710s21c1
Sequence:CCGGACAAGGAGTGTTGCGAAATTTCTCGAGAAATTTCGCAACACTCCTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1665s21c1
Sequence:CCGGGAAGATGAAGACGAGCTATTTCTCGAGAAATAGCTCGTCTTCATCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1538s21c1
Sequence:CCGGCTGTGGGACTCCAGATTATATCTCGAGATATAATCTGGAGTCCCACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1312s21c1
Sequence:CCGGGGGACCTCATGTACCACATTCCTCGAGGAATGTGGTACATGAGGTCCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000233511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-684s21c1
Sequence:CCGGACCATCCGCTCCACACTAAATCTCGAGATTTAGTGTGGAGCGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.2-1280s1c1
Sequence:CCGGGCTGTACTTCGTCATGGAATACTCGAGTATTCCATGACGAAGTACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.x-2132s1c1
Sequence:CCGGACGGCTTGTGTCTGATTCCATCTCGAGATGGAATCAGACACAAGCCGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-807s1c1
Sequence:CCGGCTTTGGAGTTTCGGAGCTGATCTCGAGATCAGCTCCGAAACTCCAAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-1659s1c1
Sequence:CCGGCGAGCTATTTCAGTCTATCATCTCGAGATGATAGACTGAAATAGCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-1930s1c1
Sequence:CCGGCCCGTCTTAACACCACCTGATCTCGAGATCAGGTGGTGTTAAGACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-921s1c1
Sequence:CCGGCATGGAACTCAGGCAGAAATTCTCGAGAATTTCTGCCTGAGTTCCATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.2-140s1c1
Sequence:CCGGCGAGGTGAAGGACCACAAATTCTCGAGAATTTGTGGTCCTTCACCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002737
PRKCA MISSION shRNA shRNA Plasmid DNA
protein kinase C, alpha
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.2-7472s1c1
Sequence:CCGGCTGAATATACTGGGCTATTTGCTCGAGCAAATAGCCCAGTATATTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.2-3403s1c1
Sequence:CCGGGACACAATTGTGCTCTATTTGCTCGAGCAAATAGAGCACAATTGTGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002737.2-6710s21c1
Sequence:CCGGACAAGGAGTGTTGCGAAATTTCTCGAGAAATTTCGCAACACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1665s21c1
Sequence:CCGGGAAGATGAAGACGAGCTATTTCTCGAGAAATAGCTCGTCTTCATCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1538s21c1
Sequence:CCGGCTGTGGGACTCCAGATTATATCTCGAGATATAATCTGGAGTCCCACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1312s21c1
Sequence:CCGGGGGACCTCATGTACCACATTCCTCGAGGAATGTGGTACATGAGGTCCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-684s21c1
Sequence:CCGGACCATCCGCTCCACACTAAATCTCGAGATTTAGTGTGGAGCGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.2-1280s1c1
Sequence:CCGGGCTGTACTTCGTCATGGAATACTCGAGTATTCCATGACGAAGTACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.x-2132s1c1
Sequence:CCGGACGGCTTGTGTCTGATTCCATCTCGAGATGGAATCAGACACAAGCCGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-807s1c1
Sequence:CCGGCTTTGGAGTTTCGGAGCTGATCTCGAGATCAGCTCCGAAACTCCAAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-1659s1c1
Sequence:CCGGCGAGCTATTTCAGTCTATCATCTCGAGATGATAGACTGAAATAGCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-1930s1c1
Sequence:CCGGCCCGTCTTAACACCACCTGATCTCGAGATCAGGTGGTGTTAAGACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-921s1c1
Sequence:CCGGCATGGAACTCAGGCAGAAATTCTCGAGAATTTCTGCCTGAGTTCCATGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.2-140s1c1
Sequence:CCGGCGAGGTGAAGGACCACAAATTCTCGAGAATTTGTGGTCCTTCACCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002737
PRKCA MISSION shRNA Lentiviral Transduction Particles
protein kinase C, alpha
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195250    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.2-7472s1c1
Sequence:CCGGCTGAATATACTGGGCTATTTGCTCGAGCAAATAGCCCAGTATATTCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196730    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.2-3403s1c1
Sequence:CCGGGACACAATTGTGCTCTATTTGCTCGAGCAAATAGAGCACAATTGTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002737.2-6710s21c1
Sequence:CCGGACAAGGAGTGTTGCGAAATTTCTCGAGAAATTTCGCAACACTCCTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1665s21c1
Sequence:CCGGGAAGATGAAGACGAGCTATTTCTCGAGAAATAGCTCGTCTTCATCTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1538s21c1
Sequence:CCGGCTGTGGGACTCCAGATTATATCTCGAGATATAATCTGGAGTCCCACAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-1312s21c1
Sequence:CCGGGGGACCTCATGTACCACATTCCTCGAGGAATGTGGTACATGAGGTCCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000233511    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002737.2-684s21c1
Sequence:CCGGACCATCCGCTCCACACTAAATCTCGAGATTTAGTGTGGAGCGGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.2-1280s1c1
Sequence:CCGGGCTGTACTTCGTCATGGAATACTCGAGTATTCCATGACGAAGTACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001694    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002737.x-2132s1c1
Sequence:CCGGACGGCTTGTGTCTGATTCCATCTCGAGATGGAATCAGACACAAGCCGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001690    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-807s1c1
Sequence:CCGGCTTTGGAGTTTCGGAGCTGATCTCGAGATCAGCTCCGAAACTCCAAAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001691    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-1659s1c1
Sequence:CCGGCGAGCTATTTCAGTCTATCATCTCGAGATGATAGACTGAAATAGCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-1930s1c1
Sequence:CCGGCCCGTCTTAACACCACCTGATCTCGAGATCAGGTGGTGTTAAGACGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001692    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.x-921s1c1
Sequence:CCGGCATGGAACTCAGGCAGAAATTCTCGAGAATTTCTGCCTGAGTTCCATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002737.2-140s1c1
Sequence:CCGGCGAGGTGAAGGACCACAAATTCTCGAGAATTTGTGGTCCTTCACCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)