EMAIL THIS PAGE TO A FRIEND

PRKCB

protein kinase C, beta

170 Gene Product Result for
Synonyms: PKC-beta PKCB PRKCB1 PRKCB2
Gene ID:
Human(5579) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(18751) protein kinase C, beta
Rat(25023) protein kinase C, beta
chicken(416567) protein kinase C, beta
domestic cat(101088970) protein kinase C, beta
dog(489968) protein kinase C, beta
Domestic Rabbit(100037719) protein kinase C, beta
naked mole-rat(101722702) protein kinase C, beta
cow(282325) protein kinase C, beta
sheep(101118410) protein kinase C, beta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504099 Anti-phospho-PKC-pan (pThr497) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504637 Anti-phospho-PKCB (pSer661) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301405 Anti-phospho-PKCB (pSer661) antibody produced in rabbit affinity isolated antibody rat, human, mouse
western blot pricing
SAB1306349 ANTI-PKC BETA1/2 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502358 Anti-PKCB antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
HPA048321 Anti-PRKCB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB1411075 Anti-PRKCB antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
proximity ligation assay, western blot pricing
HPA054203 Anti-PRKCB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
SAB2104776 Anti-PRKCB1, (N-terminal) antibody produced in rabbit affinity isolated antibody human, rabbit, rat, mouse
western blot pricing
SAB2104777 Anti-PRKCB1, (N-terminal) antibody produced in rabbit affinity isolated antibody rabbit, human, mouse, guinea pig, rat, horse
western blot pricing
P8371 Anti-Protein Kinase Cβ2 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, rat, human
western blot pricing
P3203 Anti-Protein Kinase Cβ2 antibody produced in rabbit 0.5 mg/mL, affinity isolated antibody rat
dot blot, microarray, western blot pricing
P5704 Monoclonal Anti-Protein Kinase C (PKC) antibody produced in mouse clone MC5, ascites fluid mouse, human, bovine, rat
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing
P2584 Monoclonal Anti-Protein Kinase Cβ2 antibody produced in mouse clone PK-B26, ascites fluid rat
microarray, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002738 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002738 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002738 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002738 Rosetta Predictions human pricing
NM_212535 Rosetta Predictions human pricing
NM_012713 Rosetta Predictions rat pricing
NM_008855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002738 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00071183 predicted 1539
2 SASI_Hs01_00071184 predicted 652
3 SASI_Hs01_00071185 predicted 846
4 SASI_Hs01_00071186 predicted 1060
5 SASI_Hs01_00071187 predicted 1746
6 SASI_Hs01_00071188 predicted 1808
7 SASI_Hs01_00071189 predicted 936
8 SASI_Hs01_00071190 predicted 1711
9 SASI_Hs01_00071191 predicted 1744
10 SASI_Hs01_00071192 predicted 855
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054502 predicted 1538
2 SASI_Hs01_00054503 predicted 655
3 SASI_Hs01_00054504 predicted 848
4 SASI_Hs01_00054505 predicted 1065
5 SASI_Hs01_00054506 predicted 1749
6 SASI_Hs01_00054507 predicted 1805
7 SASI_Hs01_00054508 predicted 942
8 SASI_Hs01_00054509 predicted 1713
9 SASI_Hs01_00054510 predicted 1749
10 SASI_Hs01_00054511 predicted 856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012713 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084423 predicted 1569
2 SASI_Rn01_00084424 predicted 1515
3 SASI_Rn01_00084426 predicted 2510
4 SASI_Rn01_00084427 predicted 1458
5 SASI_Rn01_00084428 predicted 1311
6 SASI_Rn02_00260047 predicted 2516
7 SASI_Rn01_00084429 predicted 1796
8 SASI_Rn01_00084430 predicted 2017
9 SASI_Rn01_00084431 predicted 2624
10 SASI_Rn02_00260048 predicted 2021
11 SASI_Rn01_00084425 predicted 2726
12 SASI_Rn01_00084432 predicted 2786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055603 predicted 620
2 SASI_Mm02_00314802 predicted 992
3 SASI_Mm01_00055605 predicted 698
4 SASI_Mm01_00055606 predicted 2047
5 SASI_Mm02_00314803 predicted 1867
6 SASI_Mm01_00055607 predicted 885
7 SASI_Mm01_00055608 predicted 1555
8 SASI_Mm01_00055609 predicted 2195
9 SASI_Mm01_00055610 predicted 856
10 SASI_Mm01_00055611 predicted 1031
11 SASI_Mm01_00055604 predicted 935
12 SASI_Mm01_00055612 predicted 1134
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002738
VALIDATED
PRKCB MISSION shRNA Bacterial Glycerol Stock
protein kinase C, beta
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002738.x-2595s1c1
Sequence:CCGGAGTGTATGGTTGCTTTGCTTACTCGAGTAAGCAAAGCAACCATACACTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.x-1834s1c1
Sequence:CCGGCTATCCCAAGTCTATGTCCAACTCGAGTTGGACATAGACTTGGGATAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.x-847s1c1
Sequence:CCGGGCTGAAAGAATCGGACAAAGACTCGAGTCTTTGTCCGATTCTTTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.x-1957s1c1
Sequence:CCGGCCGGTATATTGATTGGGAGAACTCGAGTTCTCCCAATCAATATACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.x-463s1c1
Sequence:CCGGCAAGTTTAAGATCCACACGTACTCGAGTACGTGTGGATCTTAAACTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-3108s1c1
Sequence:CCGGGACGACCTGCTTTGATTTAACCTCGAGGTTAAATCAAAGCAGGTCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.5-408s1c1
Sequence:CCGGGCCATGAATTTGTCACATTCTCTCGAGAGAATGTGACAAATTCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-745s1c1
Sequence:CCGGCCTGTCAGATCCCTACGTAAACTCGAGTTTACGTAGGGATCTGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002738.5-2215s1c1
Sequence:CCGGCGTCCTTCATTTCTGTCATTCCTCGAGGAATGACAGAAATGAAGGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-3250s1c1
Sequence:CCGGGAAACAAAGATGGTTGTATTCCTCGAGGAATACAACCATCTTTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002738.5-1703s1c1
Sequence:CCGGCCCGAGATAATTGCTTATCAGCTCGAGCTGATAAGCAATTATCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-292s21c1
Sequence:CCGGATGAGGTCAAGAACCACAAATCTCGAGATTTGTGGTTCTTGACCTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1958s21c1
Sequence:CCGGACCTGAAGGCGAACGTGATATCTCGAGATATCACGTTCGCCTTCAGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1160s21c1
Sequence:CCGGGACCAACACTGTCTCCAAATTCTCGAGAATTTGGAGACAGTGTTGGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1090s21c1
Sequence:CCGGATGAAGAACTGCGGCAGAAATCTCGAGATTTCTGCCGCAGTTCTTCATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002738
VALIDATED
PRKCB MISSION shRNA shRNA Plasmid DNA
protein kinase C, beta
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002738.x-2595s1c1
Sequence:CCGGAGTGTATGGTTGCTTTGCTTACTCGAGTAAGCAAAGCAACCATACACTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.x-1834s1c1
Sequence:CCGGCTATCCCAAGTCTATGTCCAACTCGAGTTGGACATAGACTTGGGATAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.x-847s1c1
Sequence:CCGGGCTGAAAGAATCGGACAAAGACTCGAGTCTTTGTCCGATTCTTTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.x-1957s1c1
Sequence:CCGGCCGGTATATTGATTGGGAGAACTCGAGTTCTCCCAATCAATATACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000003118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.x-463s1c1
Sequence:CCGGCAAGTTTAAGATCCACACGTACTCGAGTACGTGTGGATCTTAAACTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-3108s1c1
Sequence:CCGGGACGACCTGCTTTGATTTAACCTCGAGGTTAAATCAAAGCAGGTCGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.5-408s1c1
Sequence:CCGGGCCATGAATTTGTCACATTCTCTCGAGAGAATGTGACAAATTCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-745s1c1
Sequence:CCGGCCTGTCAGATCCCTACGTAAACTCGAGTTTACGTAGGGATCTGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002738.5-2215s1c1
Sequence:CCGGCGTCCTTCATTTCTGTCATTCCTCGAGGAATGACAGAAATGAAGGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-3250s1c1
Sequence:CCGGGAAACAAAGATGGTTGTATTCCTCGAGGAATACAACCATCTTTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002738.5-1703s1c1
Sequence:CCGGCCCGAGATAATTGCTTATCAGCTCGAGCTGATAAGCAATTATCTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000435447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-292s21c1
Sequence:CCGGATGAGGTCAAGAACCACAAATCTCGAGATTTGTGGTTCTTGACCTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000417211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1958s21c1
Sequence:CCGGACCTGAAGGCGAACGTGATATCTCGAGATATCACGTTCGCCTTCAGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1160s21c1
Sequence:CCGGGACCAACACTGTCTCCAAATTCTCGAGAATTTGGAGACAGTGTTGGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000426726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1090s21c1
Sequence:CCGGATGAAGAACTGCGGCAGAAATCTCGAGATTTCTGCCGCAGTTCTTCATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002738
VALIDATED
PRKCB MISSION shRNA Lentiviral Transduction Particles
protein kinase C, beta
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010761    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002738.x-2595s1c1
Sequence:CCGGAGTGTATGGTTGCTTTGCTTACTCGAGTAAGCAAAGCAACCATACACTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.x-1834s1c1
Sequence:CCGGCTATCCCAAGTCTATGTCCAACTCGAGTTGGACATAGACTTGGGATAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.x-847s1c1
Sequence:CCGGGCTGAAAGAATCGGACAAAGACTCGAGTCTTTGTCCGATTCTTTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.x-1957s1c1
Sequence:CCGGCCGGTATATTGATTGGGAGAACTCGAGTTCTCCCAATCAATATACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000003118    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.x-463s1c1
Sequence:CCGGCAAGTTTAAGATCCACACGTACTCGAGTACGTGTGGATCTTAAACTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-3108s1c1
Sequence:CCGGGACGACCTGCTTTGATTTAACCTCGAGGTTAAATCAAAGCAGGTCGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002738.5-408s1c1
Sequence:CCGGGCCATGAATTTGTCACATTCTCTCGAGAGAATGTGACAAATTCATGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195381    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-745s1c1
Sequence:CCGGCCTGTCAGATCCCTACGTAAACTCGAGTTTACGTAGGGATCTGACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195733    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002738.5-2215s1c1
Sequence:CCGGCGTCCTTCATTTCTGTCATTCCTCGAGGAATGACAGAAATGAAGGACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196399    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_002738.5-3250s1c1
Sequence:CCGGGAAACAAAGATGGTTGTATTCCTCGAGGAATACAACCATCTTTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002738.5-1703s1c1
Sequence:CCGGCCCGAGATAATTGCTTATCAGCTCGAGCTGATAAGCAATTATCTCGGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000435447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-292s21c1
Sequence:CCGGATGAGGTCAAGAACCACAAATCTCGAGATTTGTGGTTCTTGACCTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000417211    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1958s21c1
Sequence:CCGGACCTGAAGGCGAACGTGATATCTCGAGATATCACGTTCGCCTTCAGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1160s21c1
Sequence:CCGGGACCAACACTGTCTCCAAATTCTCGAGAATTTGGAGACAGTGTTGGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000426726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002738.6-1090s21c1
Sequence:CCGGATGAAGAACTGCGGCAGAAATCTCGAGATTTCTGCCGCAGTTCTTCATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008855
PRKCB MISSION shRNA Bacterial Glycerol Stock
protein kinase C, beta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008855.1-2087s1c1
Sequence:CCGGCCGTCCTCCATTTCTGTCATTCTCGAGAATGACAGAAATGGAGGACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-1849s1c1
Sequence:CCGGCGGTATATTGACTGGGAGAAACTCGAGTTTCTCCCAGTCAATATACCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-2004s1c1
Sequence:CCGGCCAATCAGAATTCGAAGGATTCTCGAGAATCCTTCGAATTCTGATTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-341s1c1
Sequence:CCGGCCCGGAGCAAACACAAGTTTACTCGAGTAAACTTGTGTTTGCTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-1053s1c1
Sequence:CCGGCCGGATGAAACTGACCGATTTCTCGAGAAATCGGTCAGTTTCATCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008855.2-2610s21c1
Sequence:CCGGTGAACCAAATGCTAGCAATATCTCGAGATATTGCTAGCATTTGGTTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008855.2-2054s21c1
Sequence:CCGGGAGATTCAGCCACCTTATAAACTCGAGTTTATAAGGTGGCTGAATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008855.2-791s21c1
Sequence:CCGGTTGTCAGATCCCTACGTTAAACTCGAGTTTAACGTAGGGATCTGACAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008855
PRKCB MISSION shRNA shRNA Plasmid DNA
protein kinase C, beta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008855.1-2087s1c1
Sequence:CCGGCCGTCCTCCATTTCTGTCATTCTCGAGAATGACAGAAATGGAGGACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-1849s1c1
Sequence:CCGGCGGTATATTGACTGGGAGAAACTCGAGTTTCTCCCAGTCAATATACCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-2004s1c1
Sequence:CCGGCCAATCAGAATTCGAAGGATTCTCGAGAATCCTTCGAATTCTGATTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-341s1c1
Sequence:CCGGCCCGGAGCAAACACAAGTTTACTCGAGTAAACTTGTGTTTGCTCCGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000012455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-1053s1c1
Sequence:CCGGCCGGATGAAACTGACCGATTTCTCGAGAAATCGGTCAGTTTCATCCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008855.2-2610s21c1
Sequence:CCGGTGAACCAAATGCTAGCAATATCTCGAGATATTGCTAGCATTTGGTTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008855.2-2054s21c1
Sequence:CCGGGAGATTCAGCCACCTTATAAACTCGAGTTTATAAGGTGGCTGAATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008855.2-791s21c1
Sequence:CCGGTTGTCAGATCCCTACGTTAAACTCGAGTTTAACGTAGGGATCTGACAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008855
PRKCB MISSION shRNA Lentiviral Transduction Particles
protein kinase C, beta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012453    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008855.1-2087s1c1
Sequence:CCGGCCGTCCTCCATTTCTGTCATTCTCGAGAATGACAGAAATGGAGGACGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-1849s1c1
Sequence:CCGGCGGTATATTGACTGGGAGAAACTCGAGTTTCTCCCAGTCAATATACCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-2004s1c1
Sequence:CCGGCCAATCAGAATTCGAAGGATTCTCGAGAATCCTTCGAATTCTGATTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-341s1c1
Sequence:CCGGCCCGGAGCAAACACAAGTTTACTCGAGTAAACTTGTGTTTGCTCCGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000012455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008855.1-1053s1c1
Sequence:CCGGCCGGATGAAACTGACCGATTTCTCGAGAAATCGGTCAGTTTCATCCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360309    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008855.2-2610s21c1
Sequence:CCGGTGAACCAAATGCTAGCAATATCTCGAGATATTGCTAGCATTTGGTTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360379    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008855.2-2054s21c1
Sequence:CCGGGAGATTCAGCCACCTTATAAACTCGAGTTTATAAGGTGGCTGAATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360378    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008855.2-791s21c1
Sequence:CCGGTTGTCAGATCCCTACGTTAAACTCGAGTTTAACGTAGGGATCTGACAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)