EMAIL THIS PAGE TO A FRIEND

PRKCD

protein kinase C, delta

139 Gene Product Result for
Synonyms: MAY1 PKCD nPKC-delta
UniProtKB ID: Q05655, B0KZ81, B2R834, Q15144, Q86XJ6
Gene ID:
Human(5580) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. Studies both in human and mice demonstrate that this kinase is involved in B cell signaling and in the regulation of growth, apoptosis, and differentiation of a variety of cell types. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
Mouse(18753) protein kinase C, delta
Rat(170538) protein kinase C, delta
chicken(415905) protein kinase C, delta
dog(494005) protein kinase C, delta
domestic cat(101087716) protein kinase C, delta
cow(505708) protein kinase C, delta
sheep(100294651) protein kinase C, delta
sheep(101107639) protein kinase C, delta
naked mole-rat(101718422) protein kinase C, delta
Domestic Rabbit(100008966) protein kinase C, delta
domestic guinea pig(100726624) protein kinase C, delta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302542 ANTI-MOUSE PRKCD (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504515 Anti-phospho-PKC δ (pSer645) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4504058 Anti-phospho-PKC δ (pThr505) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4301528 Anti-phospho-PKC δ (pTyr313) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4504097 Anti-phospho-PKC δ (pTyr52) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504099 Anti-phospho-PKC-pan (pThr497) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504638 Anti-phospho-PKCD (pTyr64) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, western blot pricing
SAB4301421 Anti-phospho-PKCD (pTyr64) antibody produced in rabbit affinity isolated antibody rat, human
western blot pricing
SAB4300235 Anti-phospho-PRKCD (pSer645) antibody produced in rabbit affinity isolated antibody rat, human
immunohistochemistry, western blot pricing
SAB4502360 Anti-PKC δ antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4502362 Anti-PKC δ antibody produced in rabbit affinity isolated antibody human
ELISA, immunohistochemistry, western blot pricing
SAB1306691 ANTI-PKC DELTA(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB4502363 Anti-PKCD antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4300539 Anti-PRKCD (Ab-645) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1412059 ANTI-PRKCD antibody produced in mouse clone 8G2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412060 ANTI-PRKCD antibody produced in mouse clone 8H6, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1412647 ANTI-PRKCD antibody produced in mouse clone 8E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
HPA001863 Anti-PRKCD antibody produced in rabbit Ab1, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
HPA001890 Anti-PRKCD antibody produced in rabbit Ab2, Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation human
immunofluorescence, immunohistochemistry, western blot pricing
P8333 Anti-Protein Kinase Cδ antibody produced in rabbit whole antiserum rat
dot blot, microarray, western blot pricing
WH0005580M6 Monoclonal Anti-PRKCD antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution mouse, rat, human
ELISA, immunofluorescence, western blot pricing
SAB1404242 Monoclonal Anti-PRKCD, (C-terminal) antibody produced in mouse clone 6A2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006254 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006254 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006254 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011103 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011103 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011103 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006254 Rosetta Predictions human pricing
NM_212539 Rosetta Predictions human pricing
NM_133307 Rosetta Predictions rat pricing
NM_011103 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061170 predicted 692
2 SASI_Hs02_00341193 predicted 2090
3 SASI_Hs01_00061171 predicted 2107
4 SASI_Hs01_00061172 predicted 938
5 SASI_Hs02_00341194 predicted 2198
6 SASI_Hs01_00061173 predicted 1670
7 SASI_Hs01_00061174 predicted 2243
8 SASI_Hs01_00061175 predicted 1040
9 SASI_Hs01_00061176 predicted 1463
10 SASI_Hs01_00061177 predicted 1282
11 SASI_Hs01_00061178 predicted 2016
12 SASI_Hs01_00061179 predicted 1138
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_212539 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00221622 predicted 580
2 SASI_Hs02_00374214 predicted 1983
3 SASI_Hs01_00221623 predicted 1995
4 SASI_Hs01_00221624 predicted 825
5 SASI_Hs02_00374215 predicted 2089
6 SASI_Hs01_00221625 predicted 1555
7 SASI_Hs01_00221626 predicted 2125
8 SASI_Hs01_00221627 predicted 932
9 SASI_Hs01_00221628 predicted 1346
10 SASI_Hs01_00221629 predicted 1171
11 SASI_Hs01_00221630 predicted 1897
12 SASI_Hs01_00221631 predicted 1019
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106934 predicted 2121
2 SASI_Rn01_00106935 predicted 1053
3 SASI_Rn01_00106936 predicted 525
4 SASI_Rn01_00106937 predicted 1431
5 SASI_Rn01_00106938 predicted 1468
6 SASI_Rn01_00106939 predicted 2245
7 SASI_Rn01_00106940 predicted 1675
8 SASI_Rn02_00267602 predicted 1867
9 SASI_Rn01_00106941 predicted 509
10 SASI_Rn01_00106943 predicted 1446
11 SASI_Rn01_00106942 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011103 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00319898 predicted 917
2 SASI_Mm02_00319899 predicted 2014
3 SASI_Mm02_00319900 predicted 699
4 SASI_Mm02_00319901 predicted 929
5 SASI_Mm02_00319902 predicted 462
6 SASI_Mm02_00319903 predicted 1997
7 SASI_Mm02_00319904 predicted 406
8 SASI_Mm02_00319905 predicted 1895
9 SASI_Mm02_00319906 predicted 1515
10 SASI_Mm02_00319907 predicted 1319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006254
VALIDATED
PRKCD MISSION shRNA Bacterial Glycerol Stock
protein kinase C, delta
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1146s21c1
Sequence:GTACCGGGGCATGAATGTGCACCATAAACTCGAGTTTATGGTGCACATTCATGCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-2607s21c1
Sequence:GTACCGGCATTACTTGAATGTAGTTATCCTCGAGGATAACTACATTCAAGTAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.3-1273s1c1
Sequence:CCGGCAGAGCCTGTTGGGATATATCCTCGAGGATATATCCCAACAGGCTCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006254.3-1145s1c1
Sequence:CCGGCGGCATGAATGTGCACCATAACTCGAGTTATGGTGCACATTCATGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006254.3-2676s1c1
Sequence:CCGGGCTGTATATATTGCTCAGTAGCTCGAGCTACTGAGCAATATATACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006254.3-2389s1c1
Sequence:CCGGCCTGGACAGATCAGGCTAGCCCTCGAGGGCTAGCCTGATCTGTCCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-1273s21c1
Sequence:CCGGCAGAGCCTGTTGGGATATATCCTCGAGGATATATCCCAACAGGCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1121s21c1
Sequence:CCGGGCAGGGATTAAAGTGTGAAGACTCGAGTCTTCACACTTTAATCCCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1680s21c1
Sequence:CCGGGGCCGCTTTGAACTCTACCGTCTCGAGACGGTAGAGTTCAAAGCGGCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-2577s21c1
Sequence:CCGGCTTCGGAGGGAAATTGTAAATCTCGAGATTTACAATTTCCCTCCGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-992s21c1
Sequence:CCGGCAACAGCCGGGACACTATATTCTCGAGAATATAGTGTCCCGGCTGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006254.x-1039s1c1
Sequence:CCGGGCAAGACAACAGTGGGACCTACTCGAGTAGGTCCCACTGTTGTCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.x-826s1c1
Sequence:CCGGGCAGGGATTAAAGTGTGAAGACTCGAGTCTTCACACTTTAATCCCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006254.x-611s1c1
Sequence:CCGGCAAGGCTACAAATGCAGGCAACTCGAGTTGCCTGCATTTGTAGCCTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.x-1385s1c1
Sequence:CCGGGGCCGCTTTGAACTCTACCGTCTCGAGACGGTAGAGTTCAAAGCGGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006254
VALIDATED
PRKCD MISSION shRNA shRNA Plasmid DNA
protein kinase C, delta
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1146s21c1
Sequence:GTACCGGGGCATGAATGTGCACCATAAACTCGAGTTTATGGTGCACATTCATGCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000379731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-2607s21c1
Sequence:GTACCGGCATTACTTGAATGTAGTTATCCTCGAGGATAACTACATTCAAGTAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.3-1273s1c1
Sequence:CCGGCAGAGCCTGTTGGGATATATCCTCGAGGATATATCCCAACAGGCTCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006254.3-1145s1c1
Sequence:CCGGCGGCATGAATGTGCACCATAACTCGAGTTATGGTGCACATTCATGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006254.3-2676s1c1
Sequence:CCGGGCTGTATATATTGCTCAGTAGCTCGAGCTACTGAGCAATATATACAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006254.3-2389s1c1
Sequence:CCGGCCTGGACAGATCAGGCTAGCCCTCGAGGGCTAGCCTGATCTGTCCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-1273s21c1
Sequence:CCGGCAGAGCCTGTTGGGATATATCCTCGAGGATATATCCCAACAGGCTCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1121s21c1
Sequence:CCGGGCAGGGATTAAAGTGTGAAGACTCGAGTCTTCACACTTTAATCCCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1680s21c1
Sequence:CCGGGGCCGCTTTGAACTCTACCGTCTCGAGACGGTAGAGTTCAAAGCGGCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000284800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-2577s21c1
Sequence:CCGGCTTCGGAGGGAAATTGTAAATCTCGAGATTTACAATTTCCCTCCGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-992s21c1
Sequence:CCGGCAACAGCCGGGACACTATATTCTCGAGAATATAGTGTCCCGGCTGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006254.x-1039s1c1
Sequence:CCGGGCAAGACAACAGTGGGACCTACTCGAGTAGGTCCCACTGTTGTCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.x-826s1c1
Sequence:CCGGGCAGGGATTAAAGTGTGAAGACTCGAGTCTTCACACTTTAATCCCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006254.x-611s1c1
Sequence:CCGGCAAGGCTACAAATGCAGGCAACTCGAGTTGCCTGCATTTGTAGCCTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.x-1385s1c1
Sequence:CCGGGGCCGCTTTGAACTCTACCGTCTCGAGACGGTAGAGTTCAAAGCGGCCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006254
VALIDATED
PRKCD MISSION shRNA Lentiviral Transduction Particles
protein kinase C, delta
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1146s21c1
Sequence:GTACCGGGGCATGAATGTGCACCATAAACTCGAGTTTATGGTGCACATTCATGCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000379731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-2607s21c1
Sequence:GTACCGGCATTACTTGAATGTAGTTATCCTCGAGGATAACTACATTCAAGTAATGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195408    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.3-1273s1c1
Sequence:CCGGCAGAGCCTGTTGGGATATATCCTCGAGGATATATCCCAACAGGCTCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195598    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006254.3-1145s1c1
Sequence:CCGGCGGCATGAATGTGCACCATAACTCGAGTTATGGTGCACATTCATGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196625    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006254.3-2676s1c1
Sequence:CCGGGCTGTATATATTGCTCAGTAGCTCGAGCTACTGAGCAATATATACAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199551    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006254.3-2389s1c1
Sequence:CCGGCCTGGACAGATCAGGCTAGCCCTCGAGGGCTAGCCTGATCTGTCCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-1273s21c1
Sequence:CCGGCAGAGCCTGTTGGGATATATCCTCGAGGATATATCCCAACAGGCTCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272685    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1121s21c1
Sequence:CCGGGCAGGGATTAAAGTGTGAAGACTCGAGTCTTCACACTTTAATCCCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006254.3-1680s21c1
Sequence:CCGGGGCCGCTTTGAACTCTACCGTCTCGAGACGGTAGAGTTCAAAGCGGCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000284800    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-2577s21c1
Sequence:CCGGCTTCGGAGGGAAATTGTAAATCTCGAGATTTACAATTTCCCTCCGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006254.3-992s21c1
Sequence:CCGGCAACAGCCGGGACACTATATTCTCGAGAATATAGTGTCCCGGCTGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_006254.x-1039s1c1
Sequence:CCGGGCAAGACAACAGTGGGACCTACTCGAGTAGGTCCCACTGTTGTCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.x-826s1c1
Sequence:CCGGGCAGGGATTAAAGTGTGAAGACTCGAGTCTTCACACTTTAATCCCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006254.x-611s1c1
Sequence:CCGGCAAGGCTACAAATGCAGGCAACTCGAGTTGCCTGCATTTGTAGCCTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_006254.x-1385s1c1
Sequence:CCGGGGCCGCTTTGAACTCTACCGTCTCGAGACGGTAGAGTTCAAAGCGGCCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011103
VALIDATED
PRKCD MISSION shRNA Bacterial Glycerol Stock
protein kinase C, delta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-1777s21c1
Sequence:CCGGGCTGGGAGTAACAGGAAACATCTCGAGATGTTTCCTGTTACTCCCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-1886s21c1
Sequence:CCGGCCTTCAGACTACAGCAACTTTCTCGAGAAAGTTGCTGTAGTCTGAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-701s21c1
Sequence:CCGGCCTCACCGATTCAAGGTTTATCTCGAGATAAACCTTGAATCGGTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011103.2-2005s21c1
Sequence:CCGGGAATCCCAAGTTTGAGCAATTCTCGAGAATTGCTCAAACTTGGGATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011103.1-701s1c1
Sequence:CCGGCCTCACCGATTCAAGGTTTATCTCGAGATAAACCTTGAATCGGTGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-935s1c1
Sequence:CCGGGTCGGAATATACCAGGGATTTCTCGAGAAATCCCTGGTATATTCCGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011103.1-2005s1c1
Sequence:CCGGGAATCCCAAGTTTGAGCAATTCTCGAGAATTGCTCAAACTTGGGATTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-1777s1c1
Sequence:CCGGGCTGGGAGTAACAGGAAACATCTCGAGATGTTTCCTGTTACTCCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-1886s1c1
Sequence:CCGGCCTTCAGACTACAGCAACTTTCTCGAGAAAGTTGCTGTAGTCTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011103
VALIDATED
PRKCD MISSION shRNA shRNA Plasmid DNA
protein kinase C, delta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-1777s21c1
Sequence:CCGGGCTGGGAGTAACAGGAAACATCTCGAGATGTTTCCTGTTACTCCCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-1886s21c1
Sequence:CCGGCCTTCAGACTACAGCAACTTTCTCGAGAAAGTTGCTGTAGTCTGAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-701s21c1
Sequence:CCGGCCTCACCGATTCAAGGTTTATCTCGAGATAAACCTTGAATCGGTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000280559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011103.2-2005s21c1
Sequence:CCGGGAATCCCAAGTTTGAGCAATTCTCGAGAATTGCTCAAACTTGGGATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011103.1-701s1c1
Sequence:CCGGCCTCACCGATTCAAGGTTTATCTCGAGATAAACCTTGAATCGGTGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-935s1c1
Sequence:CCGGGTCGGAATATACCAGGGATTTCTCGAGAAATCCCTGGTATATTCCGACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011103.1-2005s1c1
Sequence:CCGGGAATCCCAAGTTTGAGCAATTCTCGAGAATTGCTCAAACTTGGGATTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-1777s1c1
Sequence:CCGGGCTGGGAGTAACAGGAAACATCTCGAGATGTTTCCTGTTACTCCCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-1886s1c1
Sequence:CCGGCCTTCAGACTACAGCAACTTTCTCGAGAAAGTTGCTGTAGTCTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011103
VALIDATED
PRKCD MISSION shRNA Lentiviral Transduction Particles
protein kinase C, delta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-1777s21c1
Sequence:CCGGGCTGGGAGTAACAGGAAACATCTCGAGATGTTTCCTGTTACTCCCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-1886s21c1
Sequence:CCGGCCTTCAGACTACAGCAACTTTCTCGAGAAAGTTGCTGTAGTCTGAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011103.2-701s21c1
Sequence:CCGGCCTCACCGATTCAAGGTTTATCTCGAGATAAACCTTGAATCGGTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000280559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011103.2-2005s21c1
Sequence:CCGGGAATCCCAAGTTTGAGCAATTCTCGAGAATTGCTCAAACTTGGGATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011103.1-701s1c1
Sequence:CCGGCCTCACCGATTCAAGGTTTATCTCGAGATAAACCTTGAATCGGTGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-935s1c1
Sequence:CCGGGTCGGAATATACCAGGGATTTCTCGAGAAATCCCTGGTATATTCCGACTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022848    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011103.1-2005s1c1
Sequence:CCGGGAATCCCAAGTTTGAGCAATTCTCGAGAATTGCTCAAACTTGGGATTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-1777s1c1
Sequence:CCGGGCTGGGAGTAACAGGAAACATCTCGAGATGTTTCCTGTTACTCCCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011103.1-1886s1c1
Sequence:CCGGCCTTCAGACTACAGCAACTTTCTCGAGAAAGTTGCTGTAGTCTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)