EMAIL THIS PAGE TO A FRIEND

PRKCDBP

protein kinase C, delta binding protein

86 Gene Product Result for
Synonyms: CAVIN3 HSRBC SRBC cavin-3
UniProtKB ID: Q969G5
Gene ID:
Human(112464) Summary: The protein encoded by this gene was identified as a binding protein of the protein kinase C, delta (PRKCD). The expression of this gene in cultured cell lines is strongly induced by serum starvation. The expression of this protein was found to be down-regulated in various cancer cell lines, suggesting the possible tumor suppressor function of this protein. [provided by RefSeq, Jul 2008]
Mouse(109042) protein kinase C, delta binding protein
Rat(85332) protein kinase C, delta binding protein
domestic cat(101099244) protein kinase C, delta binding protein
dog(476831) protein kinase C, delta binding protein
domestic guinea pig(100735347) protein kinase C, delta binding protein
naked mole-rat(101698436) protein kinase C, delta binding protein
cow(510203) protein kinase C, delta binding protein
sheep(101110967) protein kinase C, delta binding protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145040 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028444 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028444 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028444 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU015271 MISSION® esiRNA esiRNA targeting mouse Prkcdbp (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145040 Rosetta Predictions human pricing
NM_134449 Rosetta Predictions rat pricing
NM_028444 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042302 predicted 223
2 SASI_Hs01_00042308 predicted 390
3 SASI_Hs02_00364916 predicted 249
4 SASI_Hs02_00364917 predicted 388
5 SASI_Hs01_00042303 predicted 776
6 SASI_Hs01_00042304 predicted 779
7 SASI_Hs01_00042305 predicted 684
8 SASI_Hs01_00042306 predicted 786
9 SASI_Hs01_00042307 predicted 804
10 SASI_Hs01_00042309 predicted 567
11 SASI_Hs01_00042310 predicted 647
12 SASI_Hs01_00042311 predicted 652
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134449 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00050426 predicted 755
2 SASI_Rn01_00050427 predicted 799
3 SASI_Rn01_00050428 predicted 789
4 SASI_Rn01_00050429 predicted 789
5 SASI_Rn01_00050430 predicted 508
6 SASI_Rn01_00050431 predicted 796
7 SASI_Rn01_00050433 predicted 577
8 SASI_Rn02_00268030 predicted 765
9 SASI_Rn01_00050434 predicted 783
10 SASI_Rn02_00268031 predicted 696
11 SASI_Rn01_00050432 predicted 524
12 SASI_Rn01_00050435 predicted 376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028444 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00076641 predicted 336
2 SASI_Mm01_00076643 predicted 781
3 SASI_Mm01_00076644 predicted 606
4 SASI_Mm01_00076645 predicted 495
5 SASI_Mm01_00076646 predicted 572
6 SASI_Mm01_00076647 predicted 510
7 SASI_Mm01_00076648 predicted 782
8 SASI_Mm01_00076649 predicted 777
9 SASI_Mm01_00076650 predicted 678
10 SASI_Mm02_00333883 predicted 541
11 SASI_Mm01_00076642 predicted 576
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145040
VALIDATED
PRKCDBP MISSION shRNA Bacterial Glycerol Stock
protein kinase C, delta binding protein
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000037792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-103s1c1
Sequence:CCGGGACGGTGGTGACCCTGCTGGACTCGAGTCCAGCAGGGTCACCACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-794s1c1
Sequence:CCGGCTGCTCCAAATGGAGAGTGTACTCGAGTACACTCTCCATTTGGAGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-572s1c1
Sequence:CCGGCGCACCGGATTGCAGAAGGTACTCGAGTACCTTCTGCAATCCGGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145040.1-783s1c1
Sequence:CCGGCCGAAGAAGCTCTGCTCCAAACTCGAGTTTGGAGCAGAGCTTCTTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145040.1-437s1c1
Sequence:CCGGGCCAGCGCTTTCCAGAAGGCACTCGAGTGCCTTCTGGAAAGCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_145040.2-842s1c1
Sequence:CCGGCCTGTGCTTGTGCCTTGTCCCCTCGAGGGGACAAGGCACAAGCACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145040.2-131s1c1
Sequence:CCGGGCCTCCATGCTGGAGACTCTGCTCGAGCAGAGTCTCCAGCATGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_145040.2-389s1c1
Sequence:CCGGCGCGGGAAGCTCCACGTTCTGCTCGAGCAGAACGTGGAGCTTCCCGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145040.2-872s1c1
Sequence:CCGGCCTTTCAGAATGTAGCACTCACTCGAGTGAGTGCTACATTCTGAAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-410s21c1
Sequence:CCGGCTCTTCAAGGAGGAGGGTGAACTCGAGTTCACCCTCCTCCTTGAAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-437s21c1
Sequence:CCGGGCCAGCGCTTTCCAGAAGGCACTCGAGTGCCTTCTGGAAAGCGCTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-872s21c1
Sequence:CCGGCCTTTCAGAATGTAGCACTCACTCGAGTGAGTGCTACATTCTGAAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-103s21c1
Sequence:CCGGGACGGTGGTGACCCTGCTGGACTCGAGTCCAGCAGGGTCACCACCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145040
VALIDATED
PRKCDBP MISSION shRNA shRNA Plasmid DNA
protein kinase C, delta binding protein
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000037792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-103s1c1
Sequence:CCGGGACGGTGGTGACCCTGCTGGACTCGAGTCCAGCAGGGTCACCACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-794s1c1
Sequence:CCGGCTGCTCCAAATGGAGAGTGTACTCGAGTACACTCTCCATTTGGAGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-572s1c1
Sequence:CCGGCGCACCGGATTGCAGAAGGTACTCGAGTACCTTCTGCAATCCGGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145040.1-783s1c1
Sequence:CCGGCCGAAGAAGCTCTGCTCCAAACTCGAGTTTGGAGCAGAGCTTCTTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000037793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145040.1-437s1c1
Sequence:CCGGGCCAGCGCTTTCCAGAAGGCACTCGAGTGCCTTCTGGAAAGCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_145040.2-842s1c1
Sequence:CCGGCCTGTGCTTGTGCCTTGTCCCCTCGAGGGGACAAGGCACAAGCACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145040.2-131s1c1
Sequence:CCGGGCCTCCATGCTGGAGACTCTGCTCGAGCAGAGTCTCCAGCATGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_145040.2-389s1c1
Sequence:CCGGCGCGGGAAGCTCCACGTTCTGCTCGAGCAGAACGTGGAGCTTCCCGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145040.2-872s1c1
Sequence:CCGGCCTTTCAGAATGTAGCACTCACTCGAGTGAGTGCTACATTCTGAAAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000370234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-410s21c1
Sequence:CCGGCTCTTCAAGGAGGAGGGTGAACTCGAGTTCACCCTCCTCCTTGAAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000289016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-437s21c1
Sequence:CCGGGCCAGCGCTTTCCAGAAGGCACTCGAGTGCCTTCTGGAAAGCGCTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-872s21c1
Sequence:CCGGCCTTTCAGAATGTAGCACTCACTCGAGTGAGTGCTACATTCTGAAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-103s21c1
Sequence:CCGGGACGGTGGTGACCCTGCTGGACTCGAGTCCAGCAGGGTCACCACCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145040
VALIDATED
PRKCDBP MISSION shRNA Lentiviral Transduction Particles
protein kinase C, delta binding protein
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000037792    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-103s1c1
Sequence:CCGGGACGGTGGTGACCCTGCTGGACTCGAGTCCAGCAGGGTCACCACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037789    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-794s1c1
Sequence:CCGGCTGCTCCAAATGGAGAGTGTACTCGAGTACACTCTCCATTTGGAGCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037790    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145040.1-572s1c1
Sequence:CCGGCGCACCGGATTGCAGAAGGTACTCGAGTACCTTCTGCAATCCGGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145040.1-783s1c1
Sequence:CCGGCCGAAGAAGCTCTGCTCCAAACTCGAGTTTGGAGCAGAGCTTCTTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000037793    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_145040.1-437s1c1
Sequence:CCGGGCCAGCGCTTTCCAGAAGGCACTCGAGTGCCTTCTGGAAAGCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199848    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_145040.2-842s1c1
Sequence:CCGGCCTGTGCTTGTGCCTTGTCCCCTCGAGGGGACAAGGCACAAGCACAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199675    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145040.2-131s1c1
Sequence:CCGGGCCTCCATGCTGGAGACTCTGCTCGAGCAGAGTCTCCAGCATGGAGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: HeLa
TRC Version: 1.5 Clone ID:NM_145040.2-389s1c1
Sequence:CCGGCGCGGGAAGCTCCACGTTCTGCTCGAGCAGAACGTGGAGCTTCCCGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194912    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145040.2-872s1c1
Sequence:CCGGCCTTTCAGAATGTAGCACTCACTCGAGTGAGTGCTACATTCTGAAAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000370234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-410s21c1
Sequence:CCGGCTCTTCAAGGAGGAGGGTGAACTCGAGTTCACCCTCCTCCTTGAAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000289016    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-437s21c1
Sequence:CCGGGCCAGCGCTTTCCAGAAGGCACTCGAGTGCCTTCTGGAAAGCGCTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296154    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-872s21c1
Sequence:CCGGCCTTTCAGAATGTAGCACTCACTCGAGTGAGTGCTACATTCTGAAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_145040.2-103s21c1
Sequence:CCGGGACGGTGGTGACCCTGCTGGACTCGAGTCCAGCAGGGTCACCACCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028444
PRKCDBP MISSION shRNA Bacterial Glycerol Stock
protein kinase C, delta binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-783s1c1
Sequence:CCGGCCTGAGAAACCCGTGCTTCAACTCGAGTTGAAGCACGGGTTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028444.1-834s1c1
Sequence:CCGGCCTGTCCCATTCGGTGCTTAACTCGAGTTAAGCACCGAATGGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-576s1c1
Sequence:CCGGCGCACTGGTTTACAGAAAGTTCTCGAGAACTTTCTGTAAACCAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-609s1c1
Sequence:CCGGAGGGCTCTTTCCAGTCGTAAACTCGAGTTTACGACTGGAAAGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-762s1c1
Sequence:CCGGCCTCAACCTACCAAGGAAGATCTCGAGATCTTCCTTGGTAGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-576s21c1
Sequence:CCGGCGCACTGGTTTACAGAAAGTTCTCGAGAACTTTCTGTAAACCAGTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-783s21c1
Sequence:CCGGCCTGAGAAACCCGTGCTTCAACTCGAGTTGAAGCACGGGTTTCTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028444.1-834s21c1
Sequence:CCGGCCTGTCCCATTCGGTGCTTAACTCGAGTTAAGCACCGAATGGGACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-609s21c1
Sequence:CCGGAGGGCTCTTTCCAGTCGTAAACTCGAGTTTACGACTGGAAAGAGCCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-762s21c1
Sequence:CCGGCCTCAACCTACCAAGGAAGATCTCGAGATCTTCCTTGGTAGGTTGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028444
PRKCDBP MISSION shRNA shRNA Plasmid DNA
protein kinase C, delta binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-783s1c1
Sequence:CCGGCCTGAGAAACCCGTGCTTCAACTCGAGTTGAAGCACGGGTTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028444.1-834s1c1
Sequence:CCGGCCTGTCCCATTCGGTGCTTAACTCGAGTTAAGCACCGAATGGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-576s1c1
Sequence:CCGGCGCACTGGTTTACAGAAAGTTCTCGAGAACTTTCTGTAAACCAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-609s1c1
Sequence:CCGGAGGGCTCTTTCCAGTCGTAAACTCGAGTTTACGACTGGAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-762s1c1
Sequence:CCGGCCTCAACCTACCAAGGAAGATCTCGAGATCTTCCTTGGTAGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-576s21c1
Sequence:CCGGCGCACTGGTTTACAGAAAGTTCTCGAGAACTTTCTGTAAACCAGTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-783s21c1
Sequence:CCGGCCTGAGAAACCCGTGCTTCAACTCGAGTTGAAGCACGGGTTTCTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028444.1-834s21c1
Sequence:CCGGCCTGTCCCATTCGGTGCTTAACTCGAGTTAAGCACCGAATGGGACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-609s21c1
Sequence:CCGGAGGGCTCTTTCCAGTCGTAAACTCGAGTTTACGACTGGAAAGAGCCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000302488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-762s21c1
Sequence:CCGGCCTCAACCTACCAAGGAAGATCTCGAGATCTTCCTTGGTAGGTTGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028444
PRKCDBP MISSION shRNA Lentiviral Transduction Particles
protein kinase C, delta binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-783s1c1
Sequence:CCGGCCTGAGAAACCCGTGCTTCAACTCGAGTTGAAGCACGGGTTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088568    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028444.1-834s1c1
Sequence:CCGGCCTGTCCCATTCGGTGCTTAACTCGAGTTAAGCACCGAATGGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-576s1c1
Sequence:CCGGCGCACTGGTTTACAGAAAGTTCTCGAGAACTTTCTGTAAACCAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-609s1c1
Sequence:CCGGAGGGCTCTTTCCAGTCGTAAACTCGAGTTTACGACTGGAAAGAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028444.1-762s1c1
Sequence:CCGGCCTCAACCTACCAAGGAAGATCTCGAGATCTTCCTTGGTAGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-576s21c1
Sequence:CCGGCGCACTGGTTTACAGAAAGTTCTCGAGAACTTTCTGTAAACCAGTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302427    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-783s21c1
Sequence:CCGGCCTGAGAAACCCGTGCTTCAACTCGAGTTGAAGCACGGGTTTCTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302426    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028444.1-834s21c1
Sequence:CCGGCCTGTCCCATTCGGTGCTTAACTCGAGTTAAGCACCGAATGGGACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302489    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-609s21c1
Sequence:CCGGAGGGCTCTTTCCAGTCGTAAACTCGAGTTTACGACTGGAAAGAGCCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000302488    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028444.1-762s21c1
Sequence:CCGGCCTCAACCTACCAAGGAAGATCTCGAGATCTTCCTTGGTAGGTTGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)