EMAIL THIS PAGE TO A FRIEND

PRKCE

protein kinase C, epsilon

177 Gene Product Result for
Synonyms: PKCE nPKC-epsilon
UniProtKB ID: Q02156, B0LPH7, Q32MQ3, Q53SL4, Q53SM5, Q9UE81
Gene ID:
Human(5581) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This kinase has been shown to be involved in many different cellular functions, such as neuron channel activation, apoptosis, cardioprotection from ischemia, heat shock response, as well as insulin exocytosis. Knockout studies in mice suggest that this kinase is important for lipopolysaccharide (LPS)-mediated signaling in activated macrophages and may also play a role in controlling anxiety-like behavior. [provided by RefSeq, Jul 2008]
Mouse(18754) protein kinase C, epsilon
Rat(29340) protein kinase C, epsilon
cow(507041) protein kinase C, epsilon
sheep(101110314) protein kinase C, epsilon
naked mole-rat(101700837) protein kinase C, epsilon
Domestic Rabbit(100009103) protein kinase C, epsilon
domestic guinea pig(100721814) protein kinase C, epsilon
chicken(421409) protein kinase C, epsilon
Horse(100053394) protein kinase C, epsilon
domestic cat(101100958) protein kinase C, epsilon
dog(609934) protein kinase C, epsilon
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011104 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011104 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011104 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005400 Rosetta Predictions human pricing
NM_017171 Rosetta Predictions rat pricing
NM_011104 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208644 predicted 1775
2 SASI_Hs01_00208645 predicted 540
3 SASI_Hs01_00208646 predicted 1680
4 SASI_Hs01_00208647 predicted 2244
5 SASI_Hs01_00208648 predicted 1288
6 SASI_Hs01_00208649 predicted 1800
7 SASI_Hs01_00208650 predicted 845
8 SASI_Hs01_00208651 predicted 1553
9 SASI_Hs01_00208652 predicted 2022
10 SASI_Hs01_00208653 predicted 2371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017171 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082045 predicted 1769
2 SASI_Rn01_00082046 predicted 1678
3 SASI_Rn01_00082047 predicted 1734
4 SASI_Rn01_00082048 predicted 2017
5 SASI_Rn01_00082049 predicted 1602
6 SASI_Rn01_00082050 predicted 2447
7 SASI_Rn01_00082051 predicted 1584
8 SASI_Rn01_00082052 predicted 776
9 SASI_Rn02_00261500 predicted 1483
10 SASI_Rn01_00082053 predicted 2243
11 SASI_Rn01_00082054 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011104 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113938 predicted 599
2 SASI_Mm01_00113939 predicted 1585
3 SASI_Mm01_00113940 predicted 1548
4 SASI_Mm01_00113941 predicted 1403
5 SASI_Mm01_00113942 predicted 1833
6 SASI_Mm01_00113943 predicted 1333
7 SASI_Mm01_00113944 predicted 1669
8 SASI_Mm01_00113945 predicted 260
9 SASI_Mm01_00113946 predicted 1881
10 SASI_Mm01_00113947 predicted 1058
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011104
VALIDATED
PRKCE MISSION shRNA Bacterial Glycerol Stock
protein kinase C, epsilon
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011104.2-1320s21c1
Sequence:CCGGGGTCTTGAAGAAGGACGTTATCTCGAGATAACGTCCTTCTTCAAGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000323440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011104.2-639s21c1
Sequence:CCGGGCGATGTCATGAGCTCATTATCTCGAGATAATGAGCTCATGACATCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1407s21c1
Sequence:CCGGCCCTTATCTAACCCAACTCTACTCGAGTAGAGTTGGGTTAGATAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1587s21c1
Sequence:CCGGCGGAGTGATCTACAGGGATTTCTCGAGAAATCCCTGTAGATCACTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1396s21c1
Sequence:CCGGGCTCGGAAACACCCTTATCTACTCGAGTAGATAAGGGTGTTTCCGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-340s1c1
Sequence:CCGGCGTCACTTCGAGGACTGGATTCTCGAGAATCCAGTCCTCGAAGTGACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-1407s1c1
Sequence:CCGGCCCTTATCTAACCCAACTCTACTCGAGTAGAGTTGGGTTAGATAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000285717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1096s21c1
Sequence:CCGGATTCGGAAGGCCTTGTCATTTCTCGAGAAATGACAAGGCCTTCCGAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-1587s1c1
Sequence:CCGGCGGAGTGATCTACAGGGATTTCTCGAGAAATCCCTGTAGATCACTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011104
VALIDATED
PRKCE MISSION shRNA shRNA Plasmid DNA
protein kinase C, epsilon
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011104.2-1320s21c1
Sequence:CCGGGGTCTTGAAGAAGGACGTTATCTCGAGATAACGTCCTTCTTCAAGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011104.2-639s21c1
Sequence:CCGGGCGATGTCATGAGCTCATTATCTCGAGATAATGAGCTCATGACATCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1407s21c1
Sequence:CCGGCCCTTATCTAACCCAACTCTACTCGAGTAGAGTTGGGTTAGATAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1587s21c1
Sequence:CCGGCGGAGTGATCTACAGGGATTTCTCGAGAAATCCCTGTAGATCACTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1396s21c1
Sequence:CCGGGCTCGGAAACACCCTTATCTACTCGAGTAGATAAGGGTGTTTCCGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-340s1c1
Sequence:CCGGCGTCACTTCGAGGACTGGATTCTCGAGAATCCAGTCCTCGAAGTGACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-1407s1c1
Sequence:CCGGCCCTTATCTAACCCAACTCTACTCGAGTAGAGTTGGGTTAGATAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1096s21c1
Sequence:CCGGATTCGGAAGGCCTTGTCATTTCTCGAGAAATGACAAGGCCTTCCGAATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-1587s1c1
Sequence:CCGGCGGAGTGATCTACAGGGATTTCTCGAGAAATCCCTGTAGATCACTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011104
VALIDATED
PRKCE MISSION shRNA Lentiviral Transduction Particles
protein kinase C, epsilon
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011104.2-1320s21c1
Sequence:CCGGGGTCTTGAAGAAGGACGTTATCTCGAGATAACGTCCTTCTTCAAGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000323440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011104.2-639s21c1
Sequence:CCGGGCGATGTCATGAGCTCATTATCTCGAGATAATGAGCTCATGACATCGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1407s21c1
Sequence:CCGGCCCTTATCTAACCCAACTCTACTCGAGTAGAGTTGGGTTAGATAAGGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285718    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1587s21c1
Sequence:CCGGCGGAGTGATCTACAGGGATTTCTCGAGAAATCCCTGTAGATCACTCCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1396s21c1
Sequence:CCGGGCTCGGAAACACCCTTATCTACTCGAGTAGATAAGGGTGTTTCCGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-340s1c1
Sequence:CCGGCGTCACTTCGAGGACTGGATTCTCGAGAATCCAGTCCTCGAAGTGACGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-1407s1c1
Sequence:CCGGCCCTTATCTAACCCAACTCTACTCGAGTAGAGTTGGGTTAGATAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000285717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011104.2-1096s21c1
Sequence:CCGGATTCGGAAGGCCTTGTCATTTCTCGAGAAATGACAAGGCCTTCCGAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011104.1-1587s1c1
Sequence:CCGGCGGAGTGATCTACAGGGATTTCTCGAGAAATCCCTGTAGATCACTCCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005400
VALIDATED
PRKCE MISSION shRNA Bacterial Glycerol Stock
protein kinase C, epsilon
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000195163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005400.2-3377s1c1
Sequence:CCGGCATCCTAAGTTCCTAGCATAACTCGAGTTATGCTAGGAACTTAGGATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-1408s1c1
Sequence:CCGGGCCTGGATGAGTTCAACTTCACTCGAGTGAAGTTGAACTCATCCAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-1496s1c1
Sequence:CCGGATATGCTGTGAAGGTCTTAAACTCGAGTTTAAGACCTTCACAGCATATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-2036s1c1
Sequence:CCGGCGACCTATTTGAGTCCATCCTCTCGAGAGGATGGACTCAAATAGGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-591s1c1
Sequence:CCGGTGTCATAGGAAAGCAGGGATACTCGAGTATCCCTGCTTTCCTATGACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-2065s1c1
Sequence:CCGGCCCTTCAAACCACGCATTAAACTCGAGTTTAATGCGTGGTTTGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005400.x-741s1c1
Sequence:CCGGCCACAAGTTCGGTATCCACAACTCGAGTTGTGGATACCGAACTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-375s1c1
Sequence:CCGGGCCAGAAGGAAGAGTGTATGTCTCGAGACATACACTCTTCCTTCTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005400.2-3977s1c1
Sequence:CCGGCTGCATGTTCAGGCATATTATCTCGAGATAATATGCCTGAACATGCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005400
VALIDATED
PRKCE MISSION shRNA shRNA Plasmid DNA
protein kinase C, epsilon
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000195163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005400.2-3377s1c1
Sequence:CCGGCATCCTAAGTTCCTAGCATAACTCGAGTTATGCTAGGAACTTAGGATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-1408s1c1
Sequence:CCGGGCCTGGATGAGTTCAACTTCACTCGAGTGAAGTTGAACTCATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-1496s1c1
Sequence:CCGGATATGCTGTGAAGGTCTTAAACTCGAGTTTAAGACCTTCACAGCATATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-2036s1c1
Sequence:CCGGCGACCTATTTGAGTCCATCCTCTCGAGAGGATGGACTCAAATAGGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-591s1c1
Sequence:CCGGTGTCATAGGAAAGCAGGGATACTCGAGTATCCCTGCTTTCCTATGACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-2065s1c1
Sequence:CCGGCCCTTCAAACCACGCATTAAACTCGAGTTTAATGCGTGGTTTGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005400.x-741s1c1
Sequence:CCGGCCACAAGTTCGGTATCCACAACTCGAGTTGTGGATACCGAACTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-375s1c1
Sequence:CCGGGCCAGAAGGAAGAGTGTATGTCTCGAGACATACACTCTTCCTTCTGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005400.2-3977s1c1
Sequence:CCGGCTGCATGTTCAGGCATATTATCTCGAGATAATATGCCTGAACATGCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005400
VALIDATED
PRKCE MISSION shRNA Lentiviral Transduction Particles
protein kinase C, epsilon
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000195163    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005400.2-3377s1c1
Sequence:CCGGCATCCTAAGTTCCTAGCATAACTCGAGTTATGCTAGGAACTTAGGATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-1408s1c1
Sequence:CCGGGCCTGGATGAGTTCAACTTCACTCGAGTGAAGTTGAACTCATCCAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219725    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-1496s1c1
Sequence:CCGGATATGCTGTGAAGGTCTTAAACTCGAGTTTAAGACCTTCACAGCATATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.2-2036s1c1
Sequence:CCGGCGACCTATTTGAGTCCATCCTCTCGAGAGGATGGACTCAAATAGGTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-591s1c1
Sequence:CCGGTGTCATAGGAAAGCAGGGATACTCGAGTATCCCTGCTTTCCTATGACATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-2065s1c1
Sequence:CCGGCCCTTCAAACCACGCATTAAACTCGAGTTTAATGCGTGGTTTGAAGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000846    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005400.x-741s1c1
Sequence:CCGGCCACAAGTTCGGTATCCACAACTCGAGTTGTGGATACCGAACTTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000848    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005400.x-375s1c1
Sequence:CCGGGCCAGAAGGAAGAGTGTATGTCTCGAGACATACACTCTTCCTTCTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219726    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005400.2-3977s1c1
Sequence:CCGGCTGCATGTTCAGGCATATTATCTCGAGATAATATGCCTGAACATGCAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)