EMAIL THIS PAGE TO A FRIEND

PRKCG

protein kinase C, gamma

61 Gene Product Result for
Synonyms: PKC-gamma PKCC PKCG SCA14
UniProtKB ID: P05129
Gene ID:
Human(5582) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play distinct roles in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase is expressed solely in the brain and spinal cord and its localization is restricted to neurons. It has been demonstrated that several neuronal functions, including long term potentiation (LTP) and long term depression (LTD), specifically require this kinase. Knockout studies in mice also suggest that this kinase may be involved in neuropathic pain development. Defects in this protein have been associated with neurodegenerative disorder spinocerebellar ataxia-14 (SCA14). [provided by RefSeq, Jul 2008]
Mouse(18752) protein kinase C, gamma
Rat(24681) protein kinase C, gamma
Zebrafish(100003514) protein kinase C, gamma
dog(484316) protein kinase C, gamma
Horse(100062549) protein kinase C, gamma
domestic cat(101082196) protein kinase C, gamma
domestic guinea pig(100733947) protein kinase C, gamma
Domestic Rabbit(100009102) protein kinase C, gamma
naked mole-rat(101698346) protein kinase C, gamma
cow(282002) protein kinase C, gamma
sheep(101116423) protein kinase C, gamma
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011102 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011102 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011102 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002739 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002739 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002739 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002739 Rosetta Predictions human pricing
NM_012628 Rosetta Predictions rat pricing
NM_011102 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002739 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00216304 predicted 2581
2 SASI_Hs01_00216305 predicted 2592
3 SASI_Hs01_00216306 predicted 907
4 SASI_Hs01_00216307 predicted 932
5 SASI_Hs01_00216308 predicted 941
6 SASI_Hs01_00216309 predicted 514
7 SASI_Hs01_00216310 predicted 2590
8 SASI_Hs01_00216311 predicted 1593
9 SASI_Hs01_00216312 predicted 485
10 SASI_Hs01_00216313 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012628 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066117 predicted 2086
2 SASI_Rn01_00066118 predicted 1363
3 SASI_Rn01_00066119 predicted 1250
4 SASI_Rn01_00066120 predicted 714
5 SASI_Rn01_00066121 predicted 452
6 SASI_Rn01_00066123 predicted 1597
7 SASI_Rn01_00066124 predicted 602
8 SASI_Rn01_00066125 predicted 1683
9 SASI_Rn01_00066126 predicted 1587
10 SASI_Rn02_00259850 predicted 1913
11 SASI_Rn01_00066122 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011102 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103462 predicted 1495
2 SASI_Mm01_00103463 predicted 484
3 SASI_Mm01_00103464 predicted 1809
4 SASI_Mm01_00103465 predicted 1959
5 SASI_Mm01_00103466 predicted 1622
6 SASI_Mm01_00103467 predicted 1817
7 SASI_Mm01_00103468 predicted 1633
8 SASI_Mm02_00319897 predicted 2420
9 SASI_Mm01_00103470 predicted 1930
10 SASI_Mm01_00103471 predicted 1694
11 SASI_Mm01_00103469 predicted 904
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011102
PRKCG MISSION shRNA Bacterial Glycerol Stock
protein kinase C, gamma
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-1455s1c1
Sequence:CCGGCGACGAACTCTATGCCATCAACTCGAGTTGATGGCATAGAGTTCGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-2346s1c1
Sequence:CCGGCCAGGGCTTTACTTATGTGAACTCGAGTTCACATAAGTAAAGCCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-441s1c1
Sequence:CCGGCCACAAGTTCACCGCTCGTTTCTCGAGAAACGAGCGGTGAACTTGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011102.3-1094s21c1
Sequence:CCGGACCAGGAGGAGGGCGAATATTCTCGAGAATATTCGCCCTCCTCCTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011102.3-763s21c1
Sequence:CCGGACGTCGGATGAGATCCATATTCTCGAGAATATGGATCTCATCCGACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011102.3-2484s21c1
Sequence:CCGGACGAGTTCTAGACGCTGTTTCCTCGAGGAAACAGCGTCTAGAACTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011102
PRKCG MISSION shRNA shRNA Plasmid DNA
protein kinase C, gamma
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-1455s1c1
Sequence:CCGGCGACGAACTCTATGCCATCAACTCGAGTTGATGGCATAGAGTTCGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-2346s1c1
Sequence:CCGGCCAGGGCTTTACTTATGTGAACTCGAGTTCACATAAGTAAAGCCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-441s1c1
Sequence:CCGGCCACAAGTTCACCGCTCGTTTCTCGAGAAACGAGCGGTGAACTTGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011102.3-1094s21c1
Sequence:CCGGACCAGGAGGAGGGCGAATATTCTCGAGAATATTCGCCCTCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011102.3-763s21c1
Sequence:CCGGACGTCGGATGAGATCCATATTCTCGAGAATATGGATCTCATCCGACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011102.3-2484s21c1
Sequence:CCGGACGAGTTCTAGACGCTGTTTCCTCGAGGAAACAGCGTCTAGAACTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011102
PRKCG MISSION shRNA Lentiviral Transduction Particles
protein kinase C, gamma
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-1455s1c1
Sequence:CCGGCGACGAACTCTATGCCATCAACTCGAGTTGATGGCATAGAGTTCGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-2346s1c1
Sequence:CCGGCCAGGGCTTTACTTATGTGAACTCGAGTTCACATAAGTAAAGCCCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011102.2-441s1c1
Sequence:CCGGCCACAAGTTCACCGCTCGTTTCTCGAGAAACGAGCGGTGAACTTGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011102.3-1094s21c1
Sequence:CCGGACCAGGAGGAGGGCGAATATTCTCGAGAATATTCGCCCTCCTCCTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361432    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011102.3-763s21c1
Sequence:CCGGACGTCGGATGAGATCCATATTCTCGAGAATATGGATCTCATCCGACGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361366    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011102.3-2484s21c1
Sequence:CCGGACGAGTTCTAGACGCTGTTTCCTCGAGGAAACAGCGTCTAGAACTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002739
PRKCG MISSION shRNA Bacterial Glycerol Stock
protein kinase C, gamma
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000010693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-395s1c1
Sequence:CCGGGCTTTGTGGTTCATCGACGATCTCGAGATCGTCGATGAACCACAAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-1789s1c1
Sequence:CCGGTCTGTCGATTGGTGGTCCTTTCTCGAGAAAGGACCACCAATCGACAGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-750s1c1
Sequence:CCGGCAATGGTCTCTCTGATCCCTACTCGAGTAGGGATCAGAGAGACCATTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.x-2502s1c1
Sequence:CCGGCCGATATTCTCCCTGACCTTACTCGAGTAAGGTCAGGGAGAATATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-852s1c1
Sequence:CCGGGTGGAATGAGACCTTTGTGTTCTCGAGAACACAAAGGTCTCATTCCACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2460s1c1
Sequence:CCGGCCTGTCCCATTCTAGATCCTGCTCGAGCAGGATCTAGAATGGGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2687s1c1
Sequence:CCGGCGAGACTCCATCTTGGTAGTTCTCGAGAACTACCAAGATGGAGTCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-1410s1c1
Sequence:CCGGCTACGCCATCAAGATCTTGAACTCGAGTTCAAGATCTTGATGGCGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-2201s1c1
Sequence:CCGGGCGAGAACTTTGACAAGTTCTCTCGAGAGAACTTGTCAAAGTTCTCGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-892s1c1
Sequence:CCGGCCTCGGAACCTGACGAAACAGCTCGAGCTGTTTCGTCAGGTTCCGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2808s1c1
Sequence:CCGGGCCTCCACTCTAGTTCTAGATCTCGAGATCTAGAACTAGAGTGGAGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002739
PRKCG MISSION shRNA shRNA Plasmid DNA
protein kinase C, gamma
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000010693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-395s1c1
Sequence:CCGGGCTTTGTGGTTCATCGACGATCTCGAGATCGTCGATGAACCACAAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-1789s1c1
Sequence:CCGGTCTGTCGATTGGTGGTCCTTTCTCGAGAAAGGACCACCAATCGACAGATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-750s1c1
Sequence:CCGGCAATGGTCTCTCTGATCCCTACTCGAGTAGGGATCAGAGAGACCATTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.x-2502s1c1
Sequence:CCGGCCGATATTCTCCCTGACCTTACTCGAGTAAGGTCAGGGAGAATATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-852s1c1
Sequence:CCGGGTGGAATGAGACCTTTGTGTTCTCGAGAACACAAAGGTCTCATTCCACTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2460s1c1
Sequence:CCGGCCTGTCCCATTCTAGATCCTGCTCGAGCAGGATCTAGAATGGGACAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2687s1c1
Sequence:CCGGCGAGACTCCATCTTGGTAGTTCTCGAGAACTACCAAGATGGAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-1410s1c1
Sequence:CCGGCTACGCCATCAAGATCTTGAACTCGAGTTCAAGATCTTGATGGCGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-2201s1c1
Sequence:CCGGGCGAGAACTTTGACAAGTTCTCTCGAGAGAACTTGTCAAAGTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-892s1c1
Sequence:CCGGCCTCGGAACCTGACGAAACAGCTCGAGCTGTTTCGTCAGGTTCCGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2808s1c1
Sequence:CCGGGCCTCCACTCTAGTTCTAGATCTCGAGATCTAGAACTAGAGTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002739
PRKCG MISSION shRNA Lentiviral Transduction Particles
protein kinase C, gamma
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000010693    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-395s1c1
Sequence:CCGGGCTTTGTGGTTCATCGACGATCTCGAGATCGTCGATGAACCACAAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-1789s1c1
Sequence:CCGGTCTGTCGATTGGTGGTCCTTTCTCGAGAAAGGACCACCAATCGACAGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002327    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-750s1c1
Sequence:CCGGCAATGGTCTCTCTGATCCCTACTCGAGTAGGGATCAGAGAGACCATTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002326    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.x-2502s1c1
Sequence:CCGGCCGATATTCTCCCTGACCTTACTCGAGTAAGGTCAGGGAGAATATCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002325    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.x-852s1c1
Sequence:CCGGGTGGAATGAGACCTTTGTGTTCTCGAGAACACAAAGGTCTCATTCCACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199544    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2460s1c1
Sequence:CCGGCCTGTCCCATTCTAGATCCTGCTCGAGCAGGATCTAGAATGGGACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199422    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2687s1c1
Sequence:CCGGCGAGACTCCATCTTGGTAGTTCTCGAGAACTACCAAGATGGAGTCTCGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195400    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-1410s1c1
Sequence:CCGGCTACGCCATCAAGATCTTGAACTCGAGTTCAAGATCTTGATGGCGTAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-2201s1c1
Sequence:CCGGGCGAGAACTTTGACAAGTTCTCTCGAGAGAACTTGTCAAAGTTCTCGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002739.3-892s1c1
Sequence:CCGGCCTCGGAACCTGACGAAACAGCTCGAGCTGTTTCGTCAGGTTCCGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199917    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002739.3-2808s1c1
Sequence:CCGGGCCTCCACTCTAGTTCTAGATCTCGAGATCTAGAACTAGAGTGGAGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)