EMAIL THIS PAGE TO A FRIEND

PRKCH

protein kinase C, eta

121 Gene Product Result for
Synonyms: PKC-L PKCL PRKCL nPKC-eta
UniProtKB ID: P24723, Q16246, Q8NE03
Gene ID:
Human(5583) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. [provided by RefSeq, Jul 2008]
Mouse(18755) protein kinase C, eta
Rat(81749) protein kinase C, eta
cow(518542) protein kinase C, eta
sheep(101105574) protein kinase C, eta
naked mole-rat(101716769) protein kinase C, eta
Domestic Rabbit(100344184) protein kinase C, eta
domestic guinea pig(100736222) protein kinase C, eta
chicken(423518) protein kinase C, eta
Horse(100051560) protein kinase C, eta
domestic cat(101082413) protein kinase C, eta
dog(490722) protein kinase C, eta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008856 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008856 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008856 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006255 Rosetta Predictions human pricing
NM_031085 Rosetta Predictions rat pricing
NM_008856 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195936 predicted 988
2 SASI_Hs01_00195937 predicted 2178
3 SASI_Hs02_00341195 predicted 1702
4 SASI_Hs01_00195938 predicted 1491
5 SASI_Hs01_00195939 predicted 1969
6 SASI_Hs01_00195940 predicted 2287
7 SASI_Hs01_00195942 predicted 950
8 SASI_Hs01_00195943 predicted 1466
9 SASI_Hs01_00195944 predicted 2442
10 SASI_Hs01_00195945 predicted 1054
11 SASI_Hs01_00195941 predicted 1868
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031085 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030091 predicted 1501
2 SASI_Rn01_00030092 predicted 191
3 SASI_Rn01_00030093 predicted 2235
4 SASI_Rn01_00030094 predicted 2005
5 SASI_Rn01_00030096 predicted 1578
6 SASI_Rn01_00030097 predicted 569
7 SASI_Rn01_00030098 predicted 2170
8 SASI_Rn01_00030099 predicted 1194
9 SASI_Rn01_00030100 predicted 2223
10 SASI_Rn02_00264325 predicted 1370
11 SASI_Rn01_00030095 predicted 1760
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008856 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106807 predicted 2076
2 SASI_Mm01_00106808 predicted 857
3 SASI_Mm01_00106809 predicted 1540
4 SASI_Mm01_00106810 predicted 1441
5 SASI_Mm01_00106812 predicted 1702
6 SASI_Mm01_00106813 predicted 2111
7 SASI_Mm01_00106814 predicted 614
8 SASI_Mm01_00106815 predicted 1091
9 SASI_Mm01_00106816 predicted 2159
10 SASI_Mm02_00314804 predicted 1557
11 SASI_Mm01_00106811 predicted 1594
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006255
VALIDATED
PRKCH MISSION shRNA Bacterial Glycerol Stock
protein kinase C, eta
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006255.3-2545s21c1
Sequence:CCGGGCACTAGAAATAGTTGATAATCTCGAGATTATCAACTATTTCTAGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-1637s1c1
Sequence:CCGGCATTCAGAAGTCTCGTCGTTTCTCGAGAAACGACGAGACTTCTGAATGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.3-2215s1c1
Sequence:CCGGCCCGAGAAGATGTCAGTAATTCTCGAGAATTACTGACATCTTCTCGGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-481s1c1
Sequence:CCGGCCAAGCAGAAGACCAACAAACCTCGAGGTTTGTTGGTCTTCTGCTTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-3076s1c1
Sequence:CCGGGTCTACTAATTTACCTGAATGCTCGAGCATTCAGGTAAATTAGTAGACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-705s21c1
Sequence:CCGGATAACCCTTACCGGGAGTTTCCTCGAGGAAACTCCCGGTAAGGGTTATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006255.2-2781s1c1
Sequence:CCGGGCTTCTTAATTCAAGAGACAACTCGAGTTGTCTCTTGAATTAAGAAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-886s1c1
Sequence:CCGGCCACCAGATCAATGGACACAACTCGAGTTGTGTCCATTGATCTGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-1026s1c1
Sequence:CCGGGCTGCCATCATCTAATTGTTACTCGAGTAACAATTAGATGATGGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000413357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-1459s21c1
Sequence:CCGGTGCTGAAGAAGGACGTGATTCCTCGAGGAATCACGTCCTTCTTCAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000419041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-2284s21c1
Sequence:CCGGAGGGACATCTTCCAATGATTACTCGAGTAATCATTGGAAGATGTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.2-2389s1c1
Sequence:CCGGCCAGGATGAGTTTAGAAACTTCTCGAGAAGTTTCTAAACTCATCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-2285s1c1
Sequence:CCGGCCCAGAATCAAATCCCGAGAACTCGAGTTCTCGGGATTTGATTCTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006255
VALIDATED
PRKCH MISSION shRNA shRNA Plasmid DNA
protein kinase C, eta
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006255.3-2545s21c1
Sequence:CCGGGCACTAGAAATAGTTGATAATCTCGAGATTATCAACTATTTCTAGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-1637s1c1
Sequence:CCGGCATTCAGAAGTCTCGTCGTTTCTCGAGAAACGACGAGACTTCTGAATGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.3-2215s1c1
Sequence:CCGGCCCGAGAAGATGTCAGTAATTCTCGAGAATTACTGACATCTTCTCGGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-481s1c1
Sequence:CCGGCCAAGCAGAAGACCAACAAACCTCGAGGTTTGTTGGTCTTCTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-3076s1c1
Sequence:CCGGGTCTACTAATTTACCTGAATGCTCGAGCATTCAGGTAAATTAGTAGACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-705s21c1
Sequence:CCGGATAACCCTTACCGGGAGTTTCCTCGAGGAAACTCCCGGTAAGGGTTATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006255.2-2781s1c1
Sequence:CCGGGCTTCTTAATTCAAGAGACAACTCGAGTTGTCTCTTGAATTAAGAAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-886s1c1
Sequence:CCGGCCACCAGATCAATGGACACAACTCGAGTTGTGTCCATTGATCTGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-1026s1c1
Sequence:CCGGGCTGCCATCATCTAATTGTTACTCGAGTAACAATTAGATGATGGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-1459s21c1
Sequence:CCGGTGCTGAAGAAGGACGTGATTCCTCGAGGAATCACGTCCTTCTTCAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-2284s21c1
Sequence:CCGGAGGGACATCTTCCAATGATTACTCGAGTAATCATTGGAAGATGTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.2-2389s1c1
Sequence:CCGGCCAGGATGAGTTTAGAAACTTCTCGAGAAGTTTCTAAACTCATCCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-2285s1c1
Sequence:CCGGCCCAGAATCAAATCCCGAGAACTCGAGTTCTCGGGATTTGATTCTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006255
VALIDATED
PRKCH MISSION shRNA Lentiviral Transduction Particles
protein kinase C, eta
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006255.3-2545s21c1
Sequence:CCGGGCACTAGAAATAGTTGATAATCTCGAGATTATCAACTATTTCTAGTGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194660    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-1637s1c1
Sequence:CCGGCATTCAGAAGTCTCGTCGTTTCTCGAGAAACGACGAGACTTCTGAATGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.3-2215s1c1
Sequence:CCGGCCCGAGAAGATGTCAGTAATTCTCGAGAATTACTGACATCTTCTCGGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195662    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-481s1c1
Sequence:CCGGCCAAGCAGAAGACCAACAAACCTCGAGGTTTGTTGGTCTTCTGCTTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196300    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.3-3076s1c1
Sequence:CCGGGTCTACTAATTTACCTGAATGCTCGAGCATTCAGGTAAATTAGTAGACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-705s21c1
Sequence:CCGGATAACCCTTACCGGGAGTTTCCTCGAGGAAACTCCCGGTAAGGGTTATTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006294    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006255.2-2781s1c1
Sequence:CCGGGCTTCTTAATTCAAGAGACAACTCGAGTTGTCTCTTGAATTAAGAAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006297    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-886s1c1
Sequence:CCGGCCACCAGATCAATGGACACAACTCGAGTTGTGTCCATTGATCTGGTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006295    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-1026s1c1
Sequence:CCGGGCTGCCATCATCTAATTGTTACTCGAGTAACAATTAGATGATGGCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000413357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-1459s21c1
Sequence:CCGGTGCTGAAGAAGGACGTGATTCCTCGAGGAATCACGTCCTTCTTCAGCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000419041    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006255.3-2284s21c1
Sequence:CCGGAGGGACATCTTCCAATGATTACTCGAGTAATCATTGGAAGATGTCCCTTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_006255.2-2389s1c1
Sequence:CCGGCCAGGATGAGTTTAGAAACTTCTCGAGAAGTTTCTAAACTCATCCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006296    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006255.2-2285s1c1
Sequence:CCGGCCCAGAATCAAATCCCGAGAACTCGAGTTCTCGGGATTTGATTCTGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008856
PRKCH MISSION shRNA Bacterial Glycerol Stock
protein kinase C, eta
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-1049s21c1
Sequence:CCGGGGGTCTCCAACCCGGAAATATCTCGAGATATTTCCGGGTTGGAGACCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-738s21c1
Sequence:CCGGTGCACCTGCGTCGTCCATAAACTCGAGTTTATGGACGACGCAGGTGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-620s21c1
Sequence:CCGGCCATCAAGTGAACGGACATAACTCGAGTTATGTCCGTTCACTTGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2079s1c1
Sequence:CCGGCCCGTCTTAACTCCGATTGATCTCGAGATCAATCGGAGTTAAGACGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-1529s1c1
Sequence:CCGGCCTACATGAGAAAGGTATCATCTCGAGATGATACCTTTCTCATGTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2091s1c1
Sequence:CCGGCCGATTGATGAGGGACATCTTCTCGAGAAGATGTCCCTCATCAATCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2019s1c1
Sequence:CCGGCCTAGAATCAAATCCCGAGAACTCGAGTTCTCGGGATTTGATTCTAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-933s1c1
Sequence:CCGGCGACAAGGACTTCAGTGTAAACTCGAGTTTACACTGAAGTCCTTGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008856
PRKCH MISSION shRNA shRNA Plasmid DNA
protein kinase C, eta
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-1049s21c1
Sequence:CCGGGGGTCTCCAACCCGGAAATATCTCGAGATATTTCCGGGTTGGAGACCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-738s21c1
Sequence:CCGGTGCACCTGCGTCGTCCATAAACTCGAGTTTATGGACGACGCAGGTGCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-620s21c1
Sequence:CCGGCCATCAAGTGAACGGACATAACTCGAGTTATGTCCGTTCACTTGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2079s1c1
Sequence:CCGGCCCGTCTTAACTCCGATTGATCTCGAGATCAATCGGAGTTAAGACGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-1529s1c1
Sequence:CCGGCCTACATGAGAAAGGTATCATCTCGAGATGATACCTTTCTCATGTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2091s1c1
Sequence:CCGGCCGATTGATGAGGGACATCTTCTCGAGAAGATGTCCCTCATCAATCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2019s1c1
Sequence:CCGGCCTAGAATCAAATCCCGAGAACTCGAGTTCTCGGGATTTGATTCTAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-933s1c1
Sequence:CCGGCGACAAGGACTTCAGTGTAAACTCGAGTTTACACTGAAGTCCTTGTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008856
PRKCH MISSION shRNA Lentiviral Transduction Particles
protein kinase C, eta
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-1049s21c1
Sequence:CCGGGGGTCTCCAACCCGGAAATATCTCGAGATATTTCCGGGTTGGAGACCCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-738s21c1
Sequence:CCGGTGCACCTGCGTCGTCCATAAACTCGAGTTTATGGACGACGCAGGTGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008856.3-620s21c1
Sequence:CCGGCCATCAAGTGAACGGACATAACTCGAGTTATGTCCGTTCACTTGATGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2079s1c1
Sequence:CCGGCCCGTCTTAACTCCGATTGATCTCGAGATCAATCGGAGTTAAGACGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022812    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-1529s1c1
Sequence:CCGGCCTACATGAGAAAGGTATCATCTCGAGATGATACCTTTCTCATGTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2091s1c1
Sequence:CCGGCCGATTGATGAGGGACATCTTCTCGAGAAGATGTCCCTCATCAATCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-2019s1c1
Sequence:CCGGCCTAGAATCAAATCCCGAGAACTCGAGTTCTCGGGATTTGATTCTAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008856.2-933s1c1
Sequence:CCGGCGACAAGGACTTCAGTGTAAACTCGAGTTTACACTGAAGTCCTTGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)