EMAIL THIS PAGE TO A FRIEND

PRKCI

protein kinase C, iota

76 Gene Product Result for
Synonyms: DXS1179E PKCI nPKC-iota
UniProtKB ID: P41743, D3DNQ4, Q8WW06
Gene ID:
Human(5584) Summary: This gene encodes a member of the protein kinase C (PKC) family of serine/threonine protein kinases. The PKC family comprises at least eight members, which are differentially expressed and are involved in a wide variety of cellular processes. This protein kinase is calcium-independent and phospholipid-dependent. It is not activated by phorbolesters or diacylglycerol. This kinase can be recruited to vesicle tubular clusters (VTCs) by direct interaction with the small GTPase RAB2, where this kinase phosphorylates glyceraldehyde-3-phosphate dehydrogenase (GAPD/GAPDH) and plays a role in microtubule dynamics in the early secretory pathway. This kinase is found to be necessary for BCL-ABL-mediated resistance to drug-induced apoptosis and therefore protects leukemia cells against drug-induced apoptosis. There is a single exon pseudogene mapped on chromosome X. [provided by RefSeq, Jul 2008]
Mouse(18759) protein kinase C, iota
Rat(84006) protein kinase C, iota
Zebrafish(117507) protein kinase C, iota
dog(478686) protein kinase C, iota
domestic cat(101087000) protein kinase C, iota
Horse(100063737) protein kinase C, iota
chicken(424991) protein kinase C, iota
cow(528478) protein kinase C, iota
sheep(101118322) protein kinase C, iota
domestic guinea pig(100731983) protein kinase C, iota
naked mole-rat(101697279) protein kinase C, iota
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306353 ANTI-PKC IOTA(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
K4642 Anti-PRKCI (221-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K1394 Anti-PRKCI (221-235) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1412358 ANTI-PRKCI antibody produced in mouse clone 1C10, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB2701768 Anti-prkci antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunohistochemistry, western blot pricing
HPA026574 Anti-PRKCI antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA038635 Anti-PRKCI antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence pricing
WH0005584M1 Monoclonal Anti-PRKCI antibody produced in mouse clone 1G11, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404243 Monoclonal Anti-PRKCI, (N-terminal) antibody produced in mouse clone 3A7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

Small Molecule - Agonist

Product # Description Species Add to Cart
 
O1008 Oleic acid ≥99% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008857 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008857 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008857 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002740 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002740 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002740 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002740 siRNAs that have been validated in the lab human pricing
NM_032059 Rosetta Predictions rat pricing
NM_008857 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002740 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026732 validated 654
2 SASI_Hs01_00026733 predicted 1952
3 SASI_Hs01_00026735 predicted 1638
4 SASI_Hs01_00026736 predicted 758
5 SASI_Hs01_00026737 predicted 475
6 SASI_Hs01_00026738 predicted 436
7 SASI_Hs01_00026739 predicted 1416
8 SASI_Hs02_00334345 predicted 1668
9 SASI_Hs01_00026740 predicted 486
10 SASI_Hs01_00026741 predicted 1612
11 SASI_Hs01_00026734 predicted 1316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265403 predicted 340
2 SASI_Rn02_00265404 predicted 809
3 SASI_Rn02_00265405 predicted 1766
4 SASI_Rn02_00265406 predicted 1937
5 SASI_Rn02_00265407 predicted 656
6 SASI_Rn02_00265408 predicted 1213
7 SASI_Rn02_00265409 predicted 1397
8 SASI_Rn02_00265410 predicted 1608
9 SASI_Rn02_00265411 predicted 1854
10 SASI_Rn02_00265412 predicted 2023
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008857 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00134911 predicted 881
2 SASI_Mm01_00134912 predicted 1605
3 SASI_Mm01_00134913 predicted 411
4 SASI_Mm01_00134915 predicted 506
5 SASI_Mm01_00134916 predicted 1171
6 SASI_Mm01_00134917 predicted 856
7 SASI_Mm01_00134918 predicted 1454
8 SASI_Mm01_00134919 predicted 323
9 SASI_Mm02_00314805 predicted 1291
10 SASI_Mm02_00314806 predicted 1353
11 SASI_Mm01_00134910 predicted 1793
12 SASI_Mm01_00134914 predicted 320
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008857
VALIDATED
PRKCI MISSION shRNA Bacterial Glycerol Stock
protein kinase C, iota
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-1196s1c1
Sequence:CCGGCGAGGGATAATTTATAGAGATCTCGAGATCTCTATAAATTATCCCTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-923s1c1
Sequence:CCGGGCAATGAAAGTTGTGAAGAAACTCGAGTTTCTTCACAACTTTCATTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008857.2-278s1c1
Sequence:CCGGCCGTTCACCATGAAATGGATACTCGAGTATCCATTTCATGGTGAACGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-1048s1c1
Sequence:CCGGCCAGACAGAAAGCAGGTTGTTCTCGAGAACAACCTGCTTTCTGTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1052s21c1
Sequence:CCGGGCAATGAAAGTTGTGAAGAAACTCGAGTTTCTTCACAACTTTCATTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1584s21c1
Sequence:CCGGGCTCTGACAATCCTGACCAAACTCGAGTTTGGTCAGGATTGTCAGAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-407s21c1
Sequence:CCGGCCGTTCACCATGAAATGGATACTCGAGTATCCATTTCATGGTGAACGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008857.3-1325s21c1
Sequence:CCGGCGAGGGATAATTTATAGAGATCTCGAGATCTCTATAAATTATCCCTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000278128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1177s21c1
Sequence:CCGGCCAGACAGAAAGCAGGTTGTTCTCGAGAACAACCTGCTTTCTGTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008857
VALIDATED
PRKCI MISSION shRNA shRNA Plasmid DNA
protein kinase C, iota
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-1196s1c1
Sequence:CCGGCGAGGGATAATTTATAGAGATCTCGAGATCTCTATAAATTATCCCTCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-923s1c1
Sequence:CCGGGCAATGAAAGTTGTGAAGAAACTCGAGTTTCTTCACAACTTTCATTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008857.2-278s1c1
Sequence:CCGGCCGTTCACCATGAAATGGATACTCGAGTATCCATTTCATGGTGAACGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-1048s1c1
Sequence:CCGGCCAGACAGAAAGCAGGTTGTTCTCGAGAACAACCTGCTTTCTGTCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1052s21c1
Sequence:CCGGGCAATGAAAGTTGTGAAGAAACTCGAGTTTCTTCACAACTTTCATTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1584s21c1
Sequence:CCGGGCTCTGACAATCCTGACCAAACTCGAGTTTGGTCAGGATTGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-407s21c1
Sequence:CCGGCCGTTCACCATGAAATGGATACTCGAGTATCCATTTCATGGTGAACGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008857.3-1325s21c1
Sequence:CCGGCGAGGGATAATTTATAGAGATCTCGAGATCTCTATAAATTATCCCTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1177s21c1
Sequence:CCGGCCAGACAGAAAGCAGGTTGTTCTCGAGAACAACCTGCTTTCTGTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008857
VALIDATED
PRKCI MISSION shRNA Lentiviral Transduction Particles
protein kinase C, iota
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000022755    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-1196s1c1
Sequence:CCGGCGAGGGATAATTTATAGAGATCTCGAGATCTCTATAAATTATCCCTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022757    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-923s1c1
Sequence:CCGGGCAATGAAAGTTGTGAAGAAACTCGAGTTTCTTCACAACTTTCATTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008857.2-278s1c1
Sequence:CCGGCCGTTCACCATGAAATGGATACTCGAGTATCCATTTCATGGTGAACGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022758    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008857.2-1048s1c1
Sequence:CCGGCCAGACAGAAAGCAGGTTGTTCTCGAGAACAACCTGCTTTCTGTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1052s21c1
Sequence:CCGGGCAATGAAAGTTGTGAAGAAACTCGAGTTTCTTCACAACTTTCATTGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297398    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1584s21c1
Sequence:CCGGGCTCTGACAATCCTGACCAAACTCGAGTTTGGTCAGGATTGTCAGAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278129    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-407s21c1
Sequence:CCGGCCGTTCACCATGAAATGGATACTCGAGTATCCATTTCATGGTGAACGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008857.3-1325s21c1
Sequence:CCGGCGAGGGATAATTTATAGAGATCTCGAGATCTCTATAAATTATCCCTCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000278128    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008857.3-1177s21c1
Sequence:CCGGCCAGACAGAAAGCAGGTTGTTCTCGAGAACAACCTGCTTTCTGTCTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002740
VALIDATED
PRKCI MISSION shRNA Bacterial Glycerol Stock
protein kinase C, iota
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000344667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-1289s21c1
Sequence:CCGGCCTGAAGAACATGCCAGATTTCTCGAGAAATCTGGCATGTTCTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-4552s1c1
Sequence:CCGGGCCATGCCAATTGTTCTTATACTCGAGTATAAGAACAATTGGCATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-2090s1c1
Sequence:CCGGGCCTGGATACAATTAACCATTCTCGAGAATGGTTAATTGTATCCAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002740.3-731s1c1
Sequence:CCGGCCAAGGATATAAGTGCATCAACTCGAGTTGATGCACTTATATCCTTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002740.3-1284s1c1
Sequence:CCGGCCTGAAGAACATGCCAGATTTCTCGAGAAATCTGGCATGTTCTTCAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-973s1c1
Sequence:CCGGCCAGTCTAGGTCTTCAGGATTCTCGAGAATCCTGAAGACCTAGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-499s1c1
Sequence:CCGGCCTTTAGACTTTATGAGCTAACTCGAGTTAGCTCATAAAGTCTAAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-978s21c1
Sequence:CCGGCCAGTCTAGGTCTTCAGGATTCTCGAGAATCCTGAAGACCTAGACTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-697s1c1
Sequence:CCGGCCATCTGCACAGACCGAATATCTCGAGATATTCGGTCTGTGCAGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-1883s1c1
Sequence:CCGGCAACTTTGATTCTCAGTTTACCTCGAGGTAAACTGAGAATCAAAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.5-1039s1c1
Sequence:CCGGAGTACTGTTGGTTCGATTAAACTCGAGTTTAATCGAACCAACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000219728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.5-1343s1c1
Sequence:CCGGCTTCATGAGCGAGGGATAATTCTCGAGAATTATCCCTCGCTCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000344616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002740.5-4557s21c1
Sequence:CCGGGCCATGCCAATTGTTCTTATACTCGAGTATAAGAACAATTGGCATGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000333005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-1039s21c1
Sequence:CCGGAGTACTGTTGGTTCGATTAAACTCGAGTTTAATCGAACCAACAGTACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002740
VALIDATED
PRKCI MISSION shRNA shRNA Plasmid DNA
protein kinase C, iota
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000344667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-1289s21c1
Sequence:CCGGCCTGAAGAACATGCCAGATTTCTCGAGAAATCTGGCATGTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-4552s1c1
Sequence:CCGGGCCATGCCAATTGTTCTTATACTCGAGTATAAGAACAATTGGCATGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-2090s1c1
Sequence:CCGGGCCTGGATACAATTAACCATTCTCGAGAATGGTTAATTGTATCCAGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002740.3-731s1c1
Sequence:CCGGCCAAGGATATAAGTGCATCAACTCGAGTTGATGCACTTATATCCTTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002740.3-1284s1c1
Sequence:CCGGCCTGAAGAACATGCCAGATTTCTCGAGAAATCTGGCATGTTCTTCAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-973s1c1
Sequence:CCGGCCAGTCTAGGTCTTCAGGATTCTCGAGAATCCTGAAGACCTAGACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-499s1c1
Sequence:CCGGCCTTTAGACTTTATGAGCTAACTCGAGTTAGCTCATAAAGTCTAAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-978s21c1
Sequence:CCGGCCAGTCTAGGTCTTCAGGATTCTCGAGAATCCTGAAGACCTAGACTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-697s1c1
Sequence:CCGGCCATCTGCACAGACCGAATATCTCGAGATATTCGGTCTGTGCAGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-1883s1c1
Sequence:CCGGCAACTTTGATTCTCAGTTTACCTCGAGGTAAACTGAGAATCAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.5-1039s1c1
Sequence:CCGGAGTACTGTTGGTTCGATTAAACTCGAGTTTAATCGAACCAACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.5-1343s1c1
Sequence:CCGGCTTCATGAGCGAGGGATAATTCTCGAGAATTATCCCTCGCTCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002740.5-4557s21c1
Sequence:CCGGGCCATGCCAATTGTTCTTATACTCGAGTATAAGAACAATTGGCATGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-1039s21c1
Sequence:CCGGAGTACTGTTGGTTCGATTAAACTCGAGTTTAATCGAACCAACAGTACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002740
VALIDATED
PRKCI MISSION shRNA Lentiviral Transduction Particles
protein kinase C, iota
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000344667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-1289s21c1
Sequence:CCGGCCTGAAGAACATGCCAGATTTCTCGAGAAATCTGGCATGTTCTTCAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196871    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-4552s1c1
Sequence:CCGGGCCATGCCAATTGTTCTTATACTCGAGTATAAGAACAATTGGCATGGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-2090s1c1
Sequence:CCGGGCCTGGATACAATTAACCATTCTCGAGAATGGTTAATTGTATCCAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002740.3-731s1c1
Sequence:CCGGCCAAGGATATAAGTGCATCAACTCGAGTTGATGCACTTATATCCTTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_002740.3-1284s1c1
Sequence:CCGGCCTGAAGAACATGCCAGATTTCTCGAGAAATCTGGCATGTTCTTCAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006041    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-973s1c1
Sequence:CCGGCCAGTCTAGGTCTTCAGGATTCTCGAGAATCCTGAAGACCTAGACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.3-499s1c1
Sequence:CCGGCCTTTAGACTTTATGAGCTAACTCGAGTTAGCTCATAAAGTCTAAAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-978s21c1
Sequence:CCGGCCAGTCTAGGTCTTCAGGATTCTCGAGAATCCTGAAGACCTAGACTGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-697s1c1
Sequence:CCGGCCATCTGCACAGACCGAATATCTCGAGATATTCGGTCTGTGCAGATGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.4-1883s1c1
Sequence:CCGGCAACTTTGATTCTCAGTTTACCTCGAGGTAAACTGAGAATCAAAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.5-1039s1c1
Sequence:CCGGAGTACTGTTGGTTCGATTAAACTCGAGTTTAATCGAACCAACAGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000219728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_002740.5-1343s1c1
Sequence:CCGGCTTCATGAGCGAGGGATAATTCTCGAGAATTATCCCTCGCTCATGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000344616    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002740.5-4557s21c1
Sequence:CCGGGCCATGCCAATTGTTCTTATACTCGAGTATAAGAACAATTGGCATGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000333005    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002740.5-1039s21c1
Sequence:CCGGAGTACTGTTGGTTCGATTAAACTCGAGTTTAATCGAACCAACAGTACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)