EMAIL THIS PAGE TO A FRIEND

PRKCZ

protein kinase C, zeta

99 Gene Product Result for
Synonyms: PKC-ZETA PKC2
Gene ID:
Human(5590) Summary: Protein kinase C (PKC) zeta is a member of the PKC family of serine/threonine kinases which are involved in a variety of cellular processes such as proliferation, differentiation and secretion. Unlike the classical PKC isoenzymes which are calcium-dependent, PKC zeta exhibits a kinase activity which is independent of calcium and diacylglycerol but not of phosphatidylserine. Furthermore, it is insensitive to typical PKC inhibitors and cannot be activated by phorbol ester. Unlike the classical PKC isoenzymes, it has only a single zinc finger module. These structural and biochemical properties indicate that the zeta subspecies is related to, but distinct from other isoenzymes of PKC. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(18762) protein kinase C, zeta
Rat(25522) protein kinase C, zeta
Domestic Rabbit(100009538) protein kinase C, zeta
naked mole-rat(101699303) protein kinase C, zeta
domestic guinea pig(100734946) protein kinase C, zeta
cow(286877) protein kinase C, zeta
sheep(101122295) protein kinase C, zeta
Zebrafish(555737) protein kinase C, zeta
chicken(419399) protein kinase C, zeta
domestic cat(101087851) protein kinase C, zeta
dog(479577) protein kinase C, zeta
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503773 Anti-phospho-PKC ζ (pThr410) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504101 Anti-phospho-PKC ζ (pThr560) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504099 Anti-phospho-PKC-pan (pThr497) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502380 Anti-PKC ζ antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306356 ANTI-PKC ZETA(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2701858 Anti-prkcz antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
HPA021851 Anti-PRKCZ antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution Antibody Enhanced Validation mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
P0713 Anti-Protein Kinase Cζ antibody produced in rabbit whole antiserum rat, mouse
microarray, western blot pricing
SAB1413172 Monoclonal Anti-PRKCZ (phospho T560) antibody produced in rabbit clone GED-16 New human
immunohistochemistry, western blot pricing
WH0005590M1 Monoclonal Anti-PRKCZ antibody produced in mouse clone 2D1, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
P5704 Monoclonal Anti-Protein Kinase C (PKC) antibody produced in mouse clone MC5, ascites fluid human, bovine, mouse, rat
immunohistochemistry, immunoprecipitation (IP), microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
SML0428 GSK690693 ≥98% (HPLC) human pricing
U6508 UCN-01 ≥97% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002744 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002744 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002744 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008860 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008860 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008860 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026811 MISSION® esiRNA targeting human PRKCZ human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033581 siRNAs that have been validated in the lab human pricing
NM_001033582 siRNAs that have been validated in the lab human pricing
NM_002744 siRNAs that have been validated in the lab human pricing
NM_022507 Rosetta Predictions rat pricing
NM_001039079 Rosetta Predictions mouse pricing
NM_008860 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033581 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116520 validated 1757
2 SASI_Hs01_00116521 predicted 750
3 SASI_Hs01_00116522 predicted 1666
4 SASI_Hs01_00116523 predicted 690
5 SASI_Hs01_00116524 predicted 1386
6 SASI_Hs01_00116525 predicted 1118
7 SASI_Hs01_00116527 predicted 1760
8 SASI_Hs01_00116528 predicted 1009
9 SASI_Hs01_00116529 predicted 572
10 SASI_Hs02_00308069 predicted 765
11 SASI_Hs01_00116526 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033582 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00241608 validated 1655
2 SASI_Hs01_00241609 predicted 652
3 SASI_Hs01_00241610 predicted 1565
4 SASI_Hs01_00241611 predicted 587
5 SASI_Hs01_00241612 predicted 1286
6 SASI_Hs01_00241613 predicted 1022
7 SASI_Hs01_00241615 predicted 1657
8 SASI_Hs01_00241616 predicted 897
9 SASI_Hs01_00241617 predicted 467
10 SASI_Hs02_00308070 predicted 666
11 SASI_Hs01_00241614 predicted 822
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002744 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202807 validated 1971
2 SASI_Hs01_00202808 predicted 966
3 SASI_Hs01_00202809 predicted 1880
4 SASI_Hs01_00202810 predicted 901
5 SASI_Hs01_00202811 predicted 1604
6 SASI_Hs01_00202812 predicted 1335
7 SASI_Hs01_00202814 predicted 1971
8 SASI_Hs01_00202815 predicted 1214
9 SASI_Hs01_00202816 predicted 788
10 SASI_Hs02_00334353 predicted 977
11 SASI_Hs01_00202813 predicted 1130
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022507 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046844 predicted 1824
2 SASI_Rn01_00046845 predicted 1454
3 SASI_Rn01_00046846 predicted 1701
4 SASI_Rn02_00263237 predicted 1399
5 SASI_Rn02_00263238 predicted 801
6 SASI_Rn01_00046847 predicted 552
7 SASI_Rn01_00046848 predicted 1952
8 SASI_Rn01_00046849 predicted 805
9 SASI_Rn01_00046850 predicted 1969
10 SASI_Rn01_00046852 predicted 1938
11 SASI_Rn01_00046851 predicted 774
12 SASI_Rn01_00046853 predicted 773
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039079 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00173845 predicted 1669
2 SASI_Mm01_00173846 predicted 1516
3 SASI_Mm01_00173849 predicted 1805
4 SASI_Mm01_00173851 predicted 639
5 SASI_Mm01_00173852 predicted 1798
6 SASI_Mm02_00289765 predicted 650
7 SASI_Mm02_00289766 predicted 1198
8 SASI_Mm02_00289767 predicted 581
9 SASI_Mm01_00173847 predicted 1243
10 SASI_Mm01_00173850 predicted 1150
11 SASI_Mm01_00173848 predicted 1807
12 SASI_Mm01_00173853 predicted 616
13 SASI_Mm01_00173854 predicted 1362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008860 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00051479 predicted 1842
2 SASI_Mm01_00051480 predicted 1698
3 SASI_Mm01_00051483 predicted 1993
4 SASI_Mm01_00051485 predicted 818
5 SASI_Mm01_00051486 predicted 1976
6 SASI_Mm02_00314808 predicted 826
7 SASI_Mm02_00314809 predicted 1380
8 SASI_Mm02_00314810 predicted 767
9 SASI_Mm01_00051481 predicted 1428
10 SASI_Mm01_00051484 predicted 1326
11 SASI_Mm01_00051482 predicted 1987
12 SASI_Mm01_00051487 predicted 793
13 SASI_Mm01_00051488 predicted 1546
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002744
VALIDATED
PRKCZ MISSION shRNA Bacterial Glycerol Stock
protein kinase C, zeta
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002744.4-1845s21c1
Sequence:GTACCGGGACGATGAGGATGCCATAAAGCTCGAGCTTTATGGCATCCTCATCGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-906s1c1
Sequence:CCGGCTGCAGGACTTTGACCTAATCCTCGAGGATTAGGTCAAAGTCCTGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002744.4-2046s1c1
Sequence:CCGGGACAGACGCTTGCGCCGAGACCTCGAGGTCTCGGCGCAAGCGTCTGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-975s1c1
Sequence:CCGGGTTGTTCCTGGTCATTGAGTACTCGAGTACTCAATGACCAGGAACAACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-576s1c1
Sequence:CCGGGCCTCCAGTAGACGACAAGAACTCGAGTTCTTGTCGTCTACTGGAGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-758s1c1
Sequence:CCGGACCTAATCAGAGTCATCGGGCCTCGAGGCCCGATGACTCTGATTAGGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-1371s1c1
Sequence:CCGGCCCGGACATGAACACAGAGGACTCGAGTCCTCTGTGTTCATGTCCGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-802s1c1
Sequence:CCGGCTGGTGCGGTTGAAGAAGAATCTCGAGATTCTTCTTCAACCGCACCAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-1608s1c1
Sequence:CCGGGCCACAGATCACAGACGACTACTCGAGTAGTCGTCTGTGATCTGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-1806s1c1
Sequence:CCGGCGCGTGATTGACCCTTTAACTCTCGAGAGTTAAAGGGTCAATCACGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000199469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-1511s1c1
Sequence:CCGGGTTCGACATCATCACCGACAACTCGAGTTGTCGGTGATGATGTCGAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-787s1c1
Sequence:CCGGCAGATGGAATTGCTTACATTTCTCGAGAAATGTAAGCAATTCCATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002744
VALIDATED
PRKCZ MISSION shRNA shRNA Plasmid DNA
protein kinase C, zeta
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002744.4-1845s21c1
Sequence:GTACCGGGACGATGAGGATGCCATAAAGCTCGAGCTTTATGGCATCCTCATCGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-906s1c1
Sequence:CCGGCTGCAGGACTTTGACCTAATCCTCGAGGATTAGGTCAAAGTCCTGCAGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002744.4-2046s1c1
Sequence:CCGGGACAGACGCTTGCGCCGAGACCTCGAGGTCTCGGCGCAAGCGTCTGTCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-975s1c1
Sequence:CCGGGTTGTTCCTGGTCATTGAGTACTCGAGTACTCAATGACCAGGAACAACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-576s1c1
Sequence:CCGGGCCTCCAGTAGACGACAAGAACTCGAGTTCTTGTCGTCTACTGGAGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-758s1c1
Sequence:CCGGACCTAATCAGAGTCATCGGGCCTCGAGGCCCGATGACTCTGATTAGGTTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-1371s1c1
Sequence:CCGGCCCGGACATGAACACAGAGGACTCGAGTCCTCTGTGTTCATGTCCGGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-802s1c1
Sequence:CCGGCTGGTGCGGTTGAAGAAGAATCTCGAGATTCTTCTTCAACCGCACCAGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-1608s1c1
Sequence:CCGGGCCACAGATCACAGACGACTACTCGAGTAGTCGTCTGTGATCTGTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-1806s1c1
Sequence:CCGGCGCGTGATTGACCCTTTAACTCTCGAGAGTTAAAGGGTCAATCACGCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000199469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-1511s1c1
Sequence:CCGGGTTCGACATCATCACCGACAACTCGAGTTGTCGGTGATGATGTCGAACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-787s1c1
Sequence:CCGGCAGATGGAATTGCTTACATTTCTCGAGAAATGTAAGCAATTCCATCTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002744
VALIDATED
PRKCZ MISSION shRNA Lentiviral Transduction Particles
protein kinase C, zeta
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379661    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_002744.4-1845s21c1
Sequence:GTACCGGGACGATGAGGATGCCATAAAGCTCGAGCTTTATGGCATCCTCATCGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-906s1c1
Sequence:CCGGCTGCAGGACTTTGACCTAATCCTCGAGGATTAGGTCAAAGTCCTGCAGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199679    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002744.4-2046s1c1
Sequence:CCGGGACAGACGCTTGCGCCGAGACCTCGAGGTCTCGGCGCAAGCGTCTGTCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-975s1c1
Sequence:CCGGGTTGTTCCTGGTCATTGAGTACTCGAGTACTCAATGACCAGGAACAACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-576s1c1
Sequence:CCGGGCCTCCAGTAGACGACAAGAACTCGAGTTCTTGTCGTCTACTGGAGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-758s1c1
Sequence:CCGGACCTAATCAGAGTCATCGGGCCTCGAGGCCCGATGACTCTGATTAGGTTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-1371s1c1
Sequence:CCGGCCCGGACATGAACACAGAGGACTCGAGTCCTCTGTGTTCATGTCCGGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-802s1c1
Sequence:CCGGCTGGTGCGGTTGAAGAAGAATCTCGAGATTCTTCTTCAACCGCACCAGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001219    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.x-1608s1c1
Sequence:CCGGGCCACAGATCACAGACGACTACTCGAGTAGTCGTCTGTGATCTGTGGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000001218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_002744.x-1806s1c1
Sequence:CCGGCGCGTGATTGACCCTTTAACTCTCGAGAGTTAAAGGGTCAATCACGCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000199469    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-1511s1c1
Sequence:CCGGGTTCGACATCATCACCGACAACTCGAGTTGTCGGTGATGATGTCGAACTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002744.4-787s1c1
Sequence:CCGGCAGATGGAATTGCTTACATTTCTCGAGAAATGTAAGCAATTCCATCTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008860
VALIDATED
PRKCZ MISSION shRNA Bacterial Glycerol Stock
protein kinase C, zeta
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008860.2-1851s21c1
Sequence:CCGGCAGATGATGAGGACGTCATAACTCGAGTTATGACGTCCTCATCATCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008860.2-2284s21c1
Sequence:CCGGTGTAATGCCCTGAGGAATAAACTCGAGTTTATTCCTCAGGGCATTACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-820s21c1
Sequence:CCGGATCTCGGAAACATGATAATATCTCGAGATATTATCATGTTTCCGAGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-565s21c1
Sequence:CCGGCTTCCAAGCCAAGCGCTTTAACTCGAGTTAAAGCGCTTGGCTTGGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-434s21c1
Sequence:CCGGGAAGTGCTCATCATTCATGTTCTCGAGAACATGAATGATGAGCACTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1736s1c1
Sequence:CCGGCCAGTCCGAATTTGAAGGCTTCTCGAGAAGCCTTCAAATTCGGACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1553s1c1
Sequence:CCGGCGACATCAAGTCTCATGCCTTCTCGAGAAGGCATGAGACTTGATGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1329s1c1
Sequence:CCGGGCACTGGGTGTCCTTATGTTTCTCGAGAAACATAAGGACACCCAGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-609s1c1
Sequence:CCGGGATGGCAAGAACGATGGTGTACTCGAGTACACCATCGTTCTTGCCATCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008860.1-288s1c1
Sequence:CCGGGAAGTGCTCATCATTCATGTTCTCGAGAACATGAATGATGAGCACTTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008860
VALIDATED
PRKCZ MISSION shRNA shRNA Plasmid DNA
protein kinase C, zeta
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008860.2-1851s21c1
Sequence:CCGGCAGATGATGAGGACGTCATAACTCGAGTTATGACGTCCTCATCATCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008860.2-2284s21c1
Sequence:CCGGTGTAATGCCCTGAGGAATAAACTCGAGTTTATTCCTCAGGGCATTACATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-820s21c1
Sequence:CCGGATCTCGGAAACATGATAATATCTCGAGATATTATCATGTTTCCGAGATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-565s21c1
Sequence:CCGGCTTCCAAGCCAAGCGCTTTAACTCGAGTTAAAGCGCTTGGCTTGGAAGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000274630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-434s21c1
Sequence:CCGGGAAGTGCTCATCATTCATGTTCTCGAGAACATGAATGATGAGCACTTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1736s1c1
Sequence:CCGGCCAGTCCGAATTTGAAGGCTTCTCGAGAAGCCTTCAAATTCGGACTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1553s1c1
Sequence:CCGGCGACATCAAGTCTCATGCCTTCTCGAGAAGGCATGAGACTTGATGTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1329s1c1
Sequence:CCGGGCACTGGGTGTCCTTATGTTTCTCGAGAAACATAAGGACACCCAGTGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-609s1c1
Sequence:CCGGGATGGCAAGAACGATGGTGTACTCGAGTACACCATCGTTCTTGCCATCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008860.1-288s1c1
Sequence:CCGGGAAGTGCTCATCATTCATGTTCTCGAGAACATGAATGATGAGCACTTCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008860
VALIDATED
PRKCZ MISSION shRNA Lentiviral Transduction Particles
protein kinase C, zeta
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274628    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008860.2-1851s21c1
Sequence:CCGGCAGATGATGAGGACGTCATAACTCGAGTTATGACGTCCTCATCATCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274629    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008860.2-2284s21c1
Sequence:CCGGTGTAATGCCCTGAGGAATAAACTCGAGTTTATTCCTCAGGGCATTACATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-820s21c1
Sequence:CCGGATCTCGGAAACATGATAATATCTCGAGATATTATCATGTTTCCGAGATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-565s21c1
Sequence:CCGGCTTCCAAGCCAAGCGCTTTAACTCGAGTTAAAGCGCTTGGCTTGGAAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008860.2-434s21c1
Sequence:CCGGGAAGTGCTCATCATTCATGTTCTCGAGAACATGAATGATGAGCACTTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1736s1c1
Sequence:CCGGCCAGTCCGAATTTGAAGGCTTCTCGAGAAGCCTTCAAATTCGGACTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1553s1c1
Sequence:CCGGCGACATCAAGTCTCATGCCTTCTCGAGAAGGCATGAGACTTGATGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-1329s1c1
Sequence:CCGGGCACTGGGTGTCCTTATGTTTCTCGAGAAACATAAGGACACCCAGTGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008860.1-609s1c1
Sequence:CCGGGATGGCAAGAACGATGGTGTACTCGAGTACACCATCGTTCTTGCCATCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008860.1-288s1c1
Sequence:CCGGGAAGTGCTCATCATTCATGTTCTCGAGAACATGAATGATGAGCACTTCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)