EMAIL THIS PAGE TO A FRIEND

PRKD1

protein kinase D1

166 Gene Product Result for
Synonyms: PKC-MU PKCM PKD PRKCM
UniProtKB ID: Q15139, A6NL64, B2RAF6
Gene ID:
Human(5587) Summary: PRKD1 is a serine/threonine kinase that regulates a variety of cellular functions, including membrane receptor signaling, transport at the Golgi, protection from oxidative stress at the mitochondria, gene transcription, and regulation of cell shape, motility, and adhesion (summary by Eiseler et al., 2009 [PubMed 19329994]
Mouse(18760) protein kinase D1
Rat(85421) protein kinase D1
cow(533270) protein kinase D1
sheep(101102016) protein kinase D1
domestic guinea pig(100722138) protein kinase D1
naked mole-rat(101705616) protein kinase D1
Zebrafish(557123) protein kinase D1
domestic cat(101080543) protein kinase D1
Horse(100054964) protein kinase D1
dog(609091) protein kinase D1
chicken(423302) protein kinase D1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302539 ANTI-MOUSE PRKD1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
SAB4504061 Anti-phospho-PKD1/2/3/PKC mu (pSer738+Ser742) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301575 Anti-phospho-PKD1/2/3/PKC μ (pSer738/742) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
SAB4504102 Anti-phospho-PKD1/PKC mu (pSer205) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4504062 Anti-phospho-PKD1/PKC mu (pSer910) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4504103 Anti-phospho-PKD1/PKC mu (pTyr463) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4301459 Anti-phospho-PKD1/PKC μ (pTyr463) antibody produced in rabbit affinity isolated antibody rat, mouse, human
western blot pricing
SAB4300060 Anti-phospho-PRKD1 (pSer738) antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunofluorescence, western blot pricing
SAB4300075 Anti-phospho-PRKD1 (pSer910) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB1306354 ANTI-PKC MU(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB4501023 Anti-PKD1 antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4502370 Anti-PKD1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, western blot pricing
SAB4502371 Anti-PKD1 antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502372 Anti-PKD1 antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301015 Anti-PKD1 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
K4767 Anti-PRKD1 (376-390) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
K4892 Anti-PRKD1 (866-880) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB4300399 Anti-PRKD1 (Ab-738) antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunofluorescence, western blot pricing
SAB4300400 Anti-PRKD1 (Ab-910) antibody produced in rabbit affinity isolated antibody human, mouse
western blot pricing
HPA029834 Anti-PRKD1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2107622 Anti-PRKD1 antibody produced in rabbit affinity isolated antibody guinea pig, horse, bovine, human, mouse, dog, rat
western blot pricing
P3987 Anti-Protein Kinase D antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunoprecipitation (IP), microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002742 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002742 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002742 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002742 Rosetta Predictions human pricing
XM_001078506 Rosetta Predictions rat pricing
XM_234108 Rosetta Predictions rat pricing
NM_008858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002742 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00334347 predicted 1845
2 SASI_Hs01_00222003 predicted 733
3 SASI_Hs01_00222004 predicted 2115
4 SASI_Hs02_00334348 predicted 1182
5 SASI_Hs02_00334349 predicted 1834
6 SASI_Hs01_00222006 predicted 1880
7 SASI_Hs01_00222007 predicted 938
8 SASI_Hs02_00334350 predicted 1317
9 SASI_Hs01_00222008 predicted 1498
10 SASI_Hs02_00334351 predicted 1388
11 SASI_Hs01_00222002 predicted 1621
12 SASI_Hs01_00222005 predicted 1586
13 SASI_Hs01_00222009 predicted 2615
14 SASI_Hs01_00222010 predicted 1213
15 SASI_Hs01_00222011 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078506 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361039 predicted 2407
2 SASI_Rn02_00361040 predicted 2196
3 SASI_Rn02_00361041 predicted 2133
4 SASI_Rn02_00361042 predicted 2074
5 SASI_Rn02_00361043 predicted 662
6 SASI_Rn02_00361044 predicted 690
7 SASI_Rn02_00361045 predicted 1346
8 SASI_Rn02_00361046 predicted 850
9 SASI_Rn02_00361047 predicted 1590
10 SASI_Rn02_00361048 predicted 472
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234108 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388284 predicted 2411
2 SASI_Rn02_00388285 predicted 2198
3 SASI_Rn02_00388286 predicted 2138
4 SASI_Rn02_00388287 predicted 2075
5 SASI_Rn02_00388288 predicted 1352
6 SASI_Rn02_00388289 predicted 2090
7 SASI_Rn02_00388290 predicted 1590
8 SASI_Rn02_00388291 predicted 1081
9 SASI_Rn02_00388292 predicted 1822
10 SASI_Rn02_00388293 predicted 1861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00187372 predicted 2334
2 SASI_Mm01_00187373 predicted 2204
3 SASI_Mm01_00187374 predicted 789
4 SASI_Mm01_00187375 predicted 977
5 SASI_Mm01_00187376 predicted 1216
6 SASI_Mm01_00187377 predicted 1233
7 SASI_Mm01_00187378 predicted 823
8 SASI_Mm01_00187379 predicted 1985
9 SASI_Mm02_00314807 predicted 1402
10 SASI_Mm01_00187381 predicted 2641
11 SASI_Mm01_00187380 predicted 390
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008858
VALIDATED
PRKD1 MISSION shRNA Bacterial Glycerol Stock
protein kinase D1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008858.1-706s1c1
Sequence:CCGGGCAGTGGAGTTAGAAGGAGAACTCGAGTTCTCCTTCTAACTCCACTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008858.1-2104s1c1
Sequence:CCGGGAGTGTTTGTTGTTATGGAAACTCGAGTTTCCATAACAACAAACACTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008858.1-1578s1c1
Sequence:CCGGCCTTCAGCTTTAACTCCCGTTCTCGAGAACGGGAGTTAAAGCTGAAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008858.1-1334s1c1
Sequence:CCGGCCCTTCAACGAGCAACAACATCTCGAGATGTTGTTGCTCGTTGAAGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-2147s21c1
Sequence:CCGGCTTCGTAATGAGGTTGCAATTCTCGAGAATTGCAACCTCATTACGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-2829s21c1
Sequence:CCGGGAATTGGAGAACGCTATATTACTCGAGTAATATAGCGTTCTCCAATTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-753s21c1
Sequence:CCGGTGGTGCGTCAAGGCCTTAAATCTCGAGATTTAAGGCCTTGACGCACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008858
VALIDATED
PRKD1 MISSION shRNA shRNA Plasmid DNA
protein kinase D1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008858.1-706s1c1
Sequence:CCGGGCAGTGGAGTTAGAAGGAGAACTCGAGTTCTCCTTCTAACTCCACTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008858.1-2104s1c1
Sequence:CCGGGAGTGTTTGTTGTTATGGAAACTCGAGTTTCCATAACAACAAACACTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008858.1-1578s1c1
Sequence:CCGGCCTTCAGCTTTAACTCCCGTTCTCGAGAACGGGAGTTAAAGCTGAAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000024005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008858.1-1334s1c1
Sequence:CCGGCCCTTCAACGAGCAACAACATCTCGAGATGTTGTTGCTCGTTGAAGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-2147s21c1
Sequence:CCGGCTTCGTAATGAGGTTGCAATTCTCGAGAATTGCAACCTCATTACGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-2829s21c1
Sequence:CCGGGAATTGGAGAACGCTATATTACTCGAGTAATATAGCGTTCTCCAATTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-753s21c1
Sequence:CCGGTGGTGCGTCAAGGCCTTAAATCTCGAGATTTAAGGCCTTGACGCACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008858
VALIDATED
PRKD1 MISSION shRNA Lentiviral Transduction Particles
protein kinase D1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008858.1-706s1c1
Sequence:CCGGGCAGTGGAGTTAGAAGGAGAACTCGAGTTCTCCTTCTAACTCCACTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008858.1-2104s1c1
Sequence:CCGGGAGTGTTTGTTGTTATGGAAACTCGAGTTTCCATAACAACAAACACTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_008858.1-1578s1c1
Sequence:CCGGCCTTCAGCTTTAACTCCCGTTCTCGAGAACGGGAGTTAAAGCTGAAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024005    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008858.1-1334s1c1
Sequence:CCGGCCCTTCAACGAGCAACAACATCTCGAGATGTTGTTGCTCGTTGAAGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-2147s21c1
Sequence:CCGGCTTCGTAATGAGGTTGCAATTCTCGAGAATTGCAACCTCATTACGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-2829s21c1
Sequence:CCGGGAATTGGAGAACGCTATATTACTCGAGTAATATAGCGTTCTCCAATTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361372    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008858.3-753s21c1
Sequence:CCGGTGGTGCGTCAAGGCCTTAAATCTCGAGATTTAAGGCCTTGACGCACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002742
VALIDATED
PRKD1 MISSION shRNA Bacterial Glycerol Stock
protein kinase D1
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000002124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.x-672s1c1
Sequence:CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.x-1556s1c1
Sequence:CCGGCGGCACTATTGGAGATTGGATCTCGAGATCCAATCTCCAATAGTGCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002742.x-2978s1c1
Sequence:CCGGCCATCTCCTATAATCTGTCAACTCGAGTTGACAGATTATAGGAGATGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.x-2498s1c1
Sequence:CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002742.2-2444s21c1
Sequence:CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002742.2-1642s21c1
Sequence:CCGGCAATCCTCATTGTTTCGAAATCTCGAGATTTCGAAACAATGAGGATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-1002s1c1
Sequence:CCGGCAATTCACCTTGACAAGATTTCTCGAGAAATCTTGTCAAGGTGAATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-1696s1c1
Sequence:CCGGCAATCCTCATTGTTTCGAAATCTCGAGATTTCGAAACAATGAGGATTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-2758s1c1
Sequence:CCGGCTATCAGACCTGGTTAGATTTCTCGAGAAATCTAACCAGGTCTGATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-2049s1c1
Sequence:CCGGCAGGAAGAGATGTAGCTATTACTCGAGTAATAGCTACATCTCTTCCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-3191s1c1
Sequence:CCGGGAAACACGAAACTTGTTATTGCTCGAGCAATAACAAGTTTCGTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-1908s1c1
Sequence:CCGGGAGATATCTCTGTGAGTATTTCTCGAGAAATACTCACAGAGATATCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-1854s21c1
Sequence:CCGGGAGATATCTCTGTGAGTATTTCTCGAGAAATACTCACAGAGATATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-2216s21c1
Sequence:CCGGCCAGAGCACATAACGAAGTTTCTCGAGAAACTTCGTTATGTGCTCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-618s21c1
Sequence:CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002742
VALIDATED
PRKD1 MISSION shRNA shRNA Plasmid DNA
protein kinase D1
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000002124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.x-672s1c1
Sequence:CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.x-1556s1c1
Sequence:CCGGCGGCACTATTGGAGATTGGATCTCGAGATCCAATCTCCAATAGTGCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002742.x-2978s1c1
Sequence:CCGGCCATCTCCTATAATCTGTCAACTCGAGTTGACAGATTATAGGAGATGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000002125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.x-2498s1c1
Sequence:CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002742.2-2444s21c1
Sequence:CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002742.2-1642s21c1
Sequence:CCGGCAATCCTCATTGTTTCGAAATCTCGAGATTTCGAAACAATGAGGATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-1002s1c1
Sequence:CCGGCAATTCACCTTGACAAGATTTCTCGAGAAATCTTGTCAAGGTGAATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-1696s1c1
Sequence:CCGGCAATCCTCATTGTTTCGAAATCTCGAGATTTCGAAACAATGAGGATTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-2758s1c1
Sequence:CCGGCTATCAGACCTGGTTAGATTTCTCGAGAAATCTAACCAGGTCTGATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-2049s1c1
Sequence:CCGGCAGGAAGAGATGTAGCTATTACTCGAGTAATAGCTACATCTCTTCCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-3191s1c1
Sequence:CCGGGAAACACGAAACTTGTTATTGCTCGAGCAATAACAAGTTTCGTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-1908s1c1
Sequence:CCGGGAGATATCTCTGTGAGTATTTCTCGAGAAATACTCACAGAGATATCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000279760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-1854s21c1
Sequence:CCGGGAGATATCTCTGTGAGTATTTCTCGAGAAATACTCACAGAGATATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-2216s21c1
Sequence:CCGGCCAGAGCACATAACGAAGTTTCTCGAGAAACTTCGTTATGTGCTCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000297327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-618s21c1
Sequence:CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002742
VALIDATED
PRKD1 MISSION shRNA Lentiviral Transduction Particles
protein kinase D1
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000002124    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.x-672s1c1
Sequence:CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.x-1556s1c1
Sequence:CCGGCGGCACTATTGGAGATTGGATCTCGAGATCCAATCTCCAATAGTGCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002126    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_002742.x-2978s1c1
Sequence:CCGGCCATCTCCTATAATCTGTCAACTCGAGTTGACAGATTATAGGAGATGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000002125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.x-2498s1c1
Sequence:CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002742.2-2444s21c1
Sequence:CCGGCTAAGGAACAAGGGCTACAATCTCGAGATTGTAGCCCTTGTTCCTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002742.2-1642s21c1
Sequence:CCGGCAATCCTCATTGTTTCGAAATCTCGAGATTTCGAAACAATGAGGATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-1002s1c1
Sequence:CCGGCAATTCACCTTGACAAGATTTCTCGAGAAATCTTGTCAAGGTGAATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195127    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-1696s1c1
Sequence:CCGGCAATCCTCATTGTTTCGAAATCTCGAGATTTCGAAACAATGAGGATTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-2758s1c1
Sequence:CCGGCTATCAGACCTGGTTAGATTTCTCGAGAAATCTAACCAGGTCTGATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-2049s1c1
Sequence:CCGGCAGGAAGAGATGTAGCTATTACTCGAGTAATAGCTACATCTCTTCCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196650    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_002742.1-3191s1c1
Sequence:CCGGGAAACACGAAACTTGTTATTGCTCGAGCAATAACAAGTTTCGTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002742.1-1908s1c1
Sequence:CCGGGAGATATCTCTGTGAGTATTTCTCGAGAAATACTCACAGAGATATCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000279760    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-1854s21c1
Sequence:CCGGGAGATATCTCTGTGAGTATTTCTCGAGAAATACTCACAGAGATATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-2216s21c1
Sequence:CCGGCCAGAGCACATAACGAAGTTTCTCGAGAAACTTCGTTATGTGCTCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000297327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002742.2-618s21c1
Sequence:CCGGCCCACGCTCTCTTTGTTCATTCTCGAGAATGAACAAAGAGAGCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)