EMAIL THIS PAGE TO A FRIEND

PRKD3

protein kinase D3

174 Gene Product Result for
Synonyms: EPK2 PKC-NU PKD3 PRKCN nPKC-NU
UniProtKB ID: O94806, D6W587, Q53TR7, Q8NEL8
Gene ID:
Human(23683) Summary: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. This kinase can be activated rapidly by the agonists of G protein-coupled receptors. It resides in both cytoplasm and nucleus, and its nuclear accumulation is found to be dramatically enhanced in response to its activation. This kinase can also be activated after B-cell antigen receptor (BCR) engagement, which requires intact phopholipase C gamma and the involvement of other PKC family members. [provided by RefSeq, Jul 2008]
Mouse(75292) protein kinase D3
Rat(313834) protein kinase D3
cow(538447) protein kinase D3
sheep(101120649) protein kinase D3
domestic guinea pig(100712662) protein kinase D3
Domestic Rabbit(100340383) protein kinase D3
naked mole-rat(101696445) protein kinase D3
Zebrafish(557337) protein kinase D3
chicken(421478) protein kinase D3
Horse(100054187) protein kinase D3
domestic cat(101100883) protein kinase D3
dog(483036) protein kinase D3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
SML0428 GSK690693 ≥98% (HPLC) human pricing
U6508 UCN-01 ≥97% (HPLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029239 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029239 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029239 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005813 Rosetta Predictions human pricing
NM_001024263 Rosetta Predictions rat pricing
XM_001054495 Rosetta Predictions rat pricing
XM_001058887 Rosetta Predictions rat pricing
NM_029239 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178017 predicted 1734
2 SASI_Hs01_00178018 predicted 1476
3 SASI_Hs01_00178019 predicted 2409
4 SASI_Hs01_00178020 predicted 2247
5 SASI_Hs01_00178022 predicted 1748
6 SASI_Hs01_00178023 predicted 1691
7 SASI_Hs01_00178024 predicted 1949
8 SASI_Hs01_00178025 predicted 3053
9 SASI_Hs02_00340338 predicted 3091
10 SASI_Hs02_00340339 predicted 1399
11 SASI_Hs01_00178021 predicted 2364
12 SASI_Hs01_00178026 predicted 2235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202430 predicted 1738
2 SASI_Rn02_00202431 predicted 3192
3 SASI_Rn02_00202432 predicted 1913
4 SASI_Rn02_00202433 predicted 3371
5 SASI_Rn02_00202434 predicted 3318
6 SASI_Rn02_00202435 predicted 1414
7 SASI_Rn02_00202436 predicted 2975
8 SASI_Rn02_00202437 predicted 2406
9 SASI_Rn02_00202438 predicted 2272
10 SASI_Rn02_00202439 predicted 3283
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054495 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00276005 predicted 1156
2 SASI_Rn02_00276006 predicted 1497
3 SASI_Rn02_00276007 predicted 1182
4 SASI_Rn02_00276008 predicted 1527
5 SASI_Rn02_00276009 predicted 1313
6 SASI_Rn02_00276010 predicted 1086
7 SASI_Rn02_00276011 predicted 1414
8 SASI_Rn02_00276012 predicted 1158
9 SASI_Rn02_00276013 predicted 1316
10 SASI_Rn02_00276014 predicted 1407
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00291167 predicted 1740
2 SASI_Rn02_00291168 predicted 3191
3 SASI_Rn02_00291169 predicted 1915
4 SASI_Rn02_00291170 predicted 3372
5 SASI_Rn02_00291171 predicted 3315
6 SASI_Rn02_00291172 predicted 1414
7 SASI_Rn02_00291173 predicted 2975
8 SASI_Rn02_00291174 predicted 2401
9 SASI_Rn02_00291175 predicted 2279
10 SASI_Rn02_00291176 predicted 3285
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029239 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087136 predicted 2199
2 SASI_Mm01_00087137 predicted 2809
3 SASI_Mm01_00087138 predicted 1207
4 SASI_Mm01_00087140 predicted 1217
5 SASI_Mm01_00087141 predicted 2774
6 SASI_Mm01_00087142 predicted 2484
7 SASI_Mm01_00087143 predicted 2649
8 SASI_Mm01_00087144 predicted 2940
9 SASI_Mm01_00087145 predicted 2895
10 SASI_Mm02_00335019 predicted 700
11 SASI_Mm01_00087139 predicted 3006
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029239
PRKD3 MISSION shRNA Bacterial Glycerol Stock
protein kinase D3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-2771s1c1
Sequence:CCGGGCATTTATGTACCCACCAAATCTCGAGATTTGGTGGGTACATAAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-1501s1c1
Sequence:CCGGGCCCGAAGACAAGATGTTCTTCTCGAGAAGAACATCTTGTCTTCGGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-1817s1c1
Sequence:CCGGCCGCAAGATTTCACCAGCATTCTCGAGAATGCTGGTGAAATCTTGCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-2943s1c1
Sequence:CCGGGCATTGGAGAACGTTACATTACTCGAGTAATGTAACGTTCTCCAATGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000024185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-744s1c1
Sequence:CCGGGCCACGACATGAACTCAGAAACTCGAGTTTCTGAGTTCATGTCGTGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029239
PRKD3 MISSION shRNA shRNA Plasmid DNA
protein kinase D3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-2771s1c1
Sequence:CCGGGCATTTATGTACCCACCAAATCTCGAGATTTGGTGGGTACATAAATGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-1501s1c1
Sequence:CCGGGCCCGAAGACAAGATGTTCTTCTCGAGAAGAACATCTTGTCTTCGGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-1817s1c1
Sequence:CCGGCCGCAAGATTTCACCAGCATTCTCGAGAATGCTGGTGAAATCTTGCGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-2943s1c1
Sequence:CCGGGCATTGGAGAACGTTACATTACTCGAGTAATGTAACGTTCTCCAATGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000024185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-744s1c1
Sequence:CCGGGCCACGACATGAACTCAGAAACTCGAGTTTCTGAGTTCATGTCGTGGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029239
PRKD3 MISSION shRNA Lentiviral Transduction Particles
protein kinase D3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024187    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-2771s1c1
Sequence:CCGGGCATTTATGTACCCACCAAATCTCGAGATTTGGTGGGTACATAAATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000024186    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-1501s1c1
Sequence:CCGGGCCCGAAGACAAGATGTTCTTCTCGAGAAGAACATCTTGTCTTCGGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000024184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-1817s1c1
Sequence:CCGGCCGCAAGATTTCACCAGCATTCTCGAGAATGCTGGTGAAATCTTGCGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000024188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-2943s1c1
Sequence:CCGGGCATTGGAGAACGTTACATTACTCGAGTAATGTAACGTTCTCCAATGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000024185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029239.2-744s1c1
Sequence:CCGGGCCACGACATGAACTCAGAAACTCGAGTTTCTGAGTTCATGTCGTGGCTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005813
VALIDATED
PRKD3 MISSION shRNA Bacterial Glycerol Stock
protein kinase D3
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-854s1c1
Sequence:CCGGGTGGATTCTTTGGCATGTATGCTCGAGCATACATGCCAAAGAATCCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-2494s21c1
Sequence:CCGGCGAGTCTTTGTAGTAATGGAACTCGAGTTCCATTACTACAAAGACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-3393s1c1
Sequence:CCGGCGGGAAACTGAATAATAAGAACTCGAGTTCTTATTATTCAGTTTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-1284s1c1
Sequence:CCGGCCAGGAACCAAGTAAGAGAATCTCGAGATTCTCTTACTTGGTTCCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-3052s1c1
Sequence:CCGGCAGGACTATCAGACTTGGCTTCTCGAGAAGCCAAGTCTGATAGTCCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.x-763s1c1
Sequence:CCGGCGGGAGAGTGTTACCATTGAACTCGAGTTCAATGGTAACACTCTCCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000001413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-2494s1c1
Sequence:CCGGCGAGTCTTTGTAGTAATGGAACTCGAGTTCCATTACTACAAAGACTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-3181s21c1
Sequence:CCGGCACTTCATTATGGCTCCTAATCTCGAGATTAGGAGCCATAATGAAGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000349631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-3052s21c1
Sequence:CCGGCAGGACTATCAGACTTGGCTTCTCGAGAAGCCAAGTCTGATAGTCCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-4946s1c1
Sequence:CCGGGCCATAGTGTTAAGTCATTATCTCGAGATAATGACTTAACACTATGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-3181s1c1
Sequence:CCGGCACTTCATTATGGCTCCTAATCTCGAGATTAGGAGCCATAATGAAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.3-1739s1c1
Sequence:CCGGGCAATAATATTCCGCTAATGACTCGAGTCATTAGCGGAATATTATTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.3-2963s1c1
Sequence:CCGGGTGAAGCAATTGATCTGATAACTCGAGTTATCAGATCAATTGCTTCACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-1284s21c1
Sequence:CCGGCCAGGAACCAAGTAAGAGAATCTCGAGATTCTCTTACTTGGTTCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000318531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005813.3-3393s21c1
Sequence:CCGGCGGGAAACTGAATAATAAGAACTCGAGTTCTTATTATTCAGTTTCCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005813
VALIDATED
PRKD3 MISSION shRNA shRNA Plasmid DNA
protein kinase D3
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-854s1c1
Sequence:CCGGGTGGATTCTTTGGCATGTATGCTCGAGCATACATGCCAAAGAATCCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-2494s21c1
Sequence:CCGGCGAGTCTTTGTAGTAATGGAACTCGAGTTCCATTACTACAAAGACTCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-3393s1c1
Sequence:CCGGCGGGAAACTGAATAATAAGAACTCGAGTTCTTATTATTCAGTTTCCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-1284s1c1
Sequence:CCGGCCAGGAACCAAGTAAGAGAATCTCGAGATTCTCTTACTTGGTTCCTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-3052s1c1
Sequence:CCGGCAGGACTATCAGACTTGGCTTCTCGAGAAGCCAAGTCTGATAGTCCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.x-763s1c1
Sequence:CCGGCGGGAGAGTGTTACCATTGAACTCGAGTTCAATGGTAACACTCTCCCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000001413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-2494s1c1
Sequence:CCGGCGAGTCTTTGTAGTAATGGAACTCGAGTTCCATTACTACAAAGACTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-3181s21c1
Sequence:CCGGCACTTCATTATGGCTCCTAATCTCGAGATTAGGAGCCATAATGAAGTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000349631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-3052s21c1
Sequence:CCGGCAGGACTATCAGACTTGGCTTCTCGAGAAGCCAAGTCTGATAGTCCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-4946s1c1
Sequence:CCGGGCCATAGTGTTAAGTCATTATCTCGAGATAATGACTTAACACTATGGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-3181s1c1
Sequence:CCGGCACTTCATTATGGCTCCTAATCTCGAGATTAGGAGCCATAATGAAGTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.3-1739s1c1
Sequence:CCGGGCAATAATATTCCGCTAATGACTCGAGTCATTAGCGGAATATTATTGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.3-2963s1c1
Sequence:CCGGGTGAAGCAATTGATCTGATAACTCGAGTTATCAGATCAATTGCTTCACTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-1284s21c1
Sequence:CCGGCCAGGAACCAAGTAAGAGAATCTCGAGATTCTCTTACTTGGTTCCTGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000318531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005813.3-3393s21c1
Sequence:CCGGCGGGAAACTGAATAATAAGAACTCGAGTTCTTATTATTCAGTTTCCCGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005813
VALIDATED
PRKD3 MISSION shRNA Lentiviral Transduction Particles
protein kinase D3
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-854s1c1
Sequence:CCGGGTGGATTCTTTGGCATGTATGCTCGAGCATACATGCCAAAGAATCCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-2494s21c1
Sequence:CCGGCGAGTCTTTGTAGTAATGGAACTCGAGTTCCATTACTACAAAGACTCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001412    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-3393s1c1
Sequence:CCGGCGGGAAACTGAATAATAAGAACTCGAGTTCTTATTATTCAGTTTCCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-1284s1c1
Sequence:CCGGCCAGGAACCAAGTAAGAGAATCTCGAGATTCTCTTACTTGGTTCCTGGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001416    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-3052s1c1
Sequence:CCGGCAGGACTATCAGACTTGGCTTCTCGAGAAGCCAAGTCTGATAGTCCTGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.x-763s1c1
Sequence:CCGGCGGGAGAGTGTTACCATTGAACTCGAGTTCAATGGTAACACTCTCCCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000001413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.x-2494s1c1
Sequence:CCGGCGAGTCTTTGTAGTAATGGAACTCGAGTTCCATTACTACAAAGACTCGTTTTT
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318590    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-3181s21c1
Sequence:CCGGCACTTCATTATGGCTCCTAATCTCGAGATTAGGAGCCATAATGAAGTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000349631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-3052s21c1
Sequence:CCGGCAGGACTATCAGACTTGGCTTCTCGAGAAGCCAAGTCTGATAGTCCTGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-4946s1c1
Sequence:CCGGGCCATAGTGTTAAGTCATTATCTCGAGATAATGACTTAACACTATGGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000195275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_005813.3-3181s1c1
Sequence:CCGGCACTTCATTATGGCTCCTAATCTCGAGATTAGGAGCCATAATGAAGTGTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196249    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.3-1739s1c1
Sequence:CCGGGCAATAATATTCCGCTAATGACTCGAGTCATTAGCGGAATATTATTGCTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000196715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005813.3-2963s1c1
Sequence:CCGGGTGAAGCAATTGATCTGATAACTCGAGTTATCAGATCAATTGCTTCACTTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005813.3-1284s21c1
Sequence:CCGGCCAGGAACCAAGTAAGAGAATCTCGAGATTCTCTTACTTGGTTCCTGGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???
TRCN0000318531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005813.3-3393s21c1
Sequence:CCGGCGGGAAACTGAATAATAAGAACTCGAGTTCTTATTATTCAGTTTCCCGTTTTTG
Availability: ???SHIPS_IN_4-5_WEEKS_ROW???