EMAIL THIS PAGE TO A FRIEND

PRKDC

protein kinase, DNA-activated, catalytic polypeptide

107 Gene Product Result for
Synonyms: DNA-PKcs DNAPK DNPK1 HYRC HYRC1 XRCC7 p350
Gene ID:
Human(5591) Summary: This gene encodes the catalytic subunit of the DNA-dependent protein kinase (DNA-PK). It functions with the Ku70/Ku80 heterodimer protein in DNA double strand break repair and recombination. The protein encoded is a member of the PI3/PI4-kinase family.[provided by RefSeq, Jul 2010]
Mouse(19090) protein kinase, DNA activated, catalytic polypeptide
Rat(360748) protein kinase, DNA activated, catalytic polypeptide
chicken(395376) protein kinase, DNA-activated, catalytic polypeptide
dog(474176) protein kinase, DNA-activated, catalytic polypeptide
domestic cat(101088389) protein kinase, DNA-activated, catalytic polypeptide
naked mole-rat(101722248) protein kinase, DNA-activated, catalytic polypeptide
Domestic Rabbit(100125348) protein kinase, DNA-activated, catalytic polypeptide
domestic guinea pig(100724826) protein kinase, DNA-activated, catalytic polypeptide
cow(512740) protein kinase, DNA-activated, catalytic polypeptide
sheep(101111377) protein kinase, DNA-activated, catalytic polypeptide
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4502381 Anti-DNA-PK antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
SAB4502382 Anti-DNA-PK antibody produced in rabbit affinity isolated antibody human
ELISA, immunofluorescence pricing
SAB4502383 Anti-DNA-PK antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence pricing
SAB4502384 Anti-DNA-PK antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunohistochemistry pricing
SAB4502385 Anti-DNA-PK antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504169 Anti-phospho-DNA-PK (pSer2056) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB1305579 ANTI-PHOSPHO-DNA-PK(T2609) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
SAB4300137 Anti-phospho-PRKDC (pThr2609) antibody produced in rabbit affinity isolated antibody human
western blot pricing
SAB4300443 Anti-PRKDC (Ab-2609) antibody produced in rabbit affinity isolated antibody human
western blot pricing
P9870 Anti-PRKDC antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunocytochemistry, immunohistochemistry pricing
HPA035174 Anti-PRKDC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0005591M2 Monoclonal Anti-PRKDC antibody produced in mouse clone 1B9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404245 Monoclonal Anti-PRKDC, (C-terminal) antibody produced in mouse clone 2A8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PLA0115 Rabbit anti-DNA-PKcs Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, gorilla, chimpanzee, rhesus monkey
immunoprecipitation (IP), proximity ligation assay, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
N5757 α-Naphthoflavone ≥98% human, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006904 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006904 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006904 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001081640 Rosetta Predictions human pricing
NM_006904 siRNAs that have been validated in the lab human pricing
NM_001108327 Rosetta Predictions rat pricing
NM_011159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081640 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00316503 predicted 2917
2 SASI_Hs02_00316504 predicted 2565
3 SASI_Hs02_00316505 predicted 3500
4 SASI_Hs02_00316506 predicted 8558
5 SASI_Hs02_00316507 predicted 5886
6 SASI_Hs02_00316508 predicted 914
7 SASI_Hs02_00316509 predicted 3000
8 SASI_Hs02_00316510 predicted 813
9 SASI_Hs02_00316511 predicted 9092
10 SASI_Hs02_00316512 predicted 10622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006904 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134549 validated 2924
1 SASI_Hs01_00134550 validated 2567
1 SASI_Hs01_00134551 validated 6689
2 SASI_Hs01_00134552 predicted 3508
3 SASI_Hs01_00134553 predicted 8565
4 SASI_Hs01_00134554 predicted 5884
5 SASI_Hs01_00134555 predicted 918
6 SASI_Hs01_00134556 predicted 2996
7 SASI_Hs01_00134557 predicted 818
8 SASI_Hs02_00342583 predicted 9089
9 SASI_Hs02_00342584 predicted 10619
10 SASI_Hs01_00134558 predicted 11190
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108327 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00237569 predicted 7372
2 SASI_Rn02_00237570 predicted 6823
3 SASI_Rn02_00237571 predicted 5422
4 SASI_Rn02_00237572 predicted 8741
5 SASI_Rn02_00237573 predicted 5837
6 SASI_Rn02_00237574 predicted 8751
7 SASI_Rn02_00237575 predicted 7415
8 SASI_Rn02_00237576 predicted 7411
9 SASI_Rn02_00237577 predicted 6842
10 SASI_Rn02_00237578 predicted 5114
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00320021 predicted 2806
2 SASI_Mm01_00043463 predicted 7561
3 SASI_Mm01_00043464 predicted 6885
4 SASI_Mm02_00320022 predicted 8189
5 SASI_Mm02_00320023 predicted 9061
6 SASI_Mm01_00043465 predicted 824
7 SASI_Mm02_00320024 predicted 3758
8 SASI_Mm01_00043466 predicted 11386
9 SASI_Mm01_00043468 predicted 2889
10 SASI_Mm01_00043469 predicted 794
11 SASI_Mm01_00043461 predicted 4091
12 SASI_Mm01_00043462 predicted 5504
13 SASI_Mm01_00043467 predicted 888
14 SASI_Mm01_00043470 predicted 7522
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011159
PRKDC MISSION shRNA Bacterial Glycerol Stock
protein kinase, DNA-activated, catalytic polypeptide
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-11904s21c1
Sequence:CCGGTTTCGTCTAACCCGCCAATTTCTCGAGAAATTGGCGGGTTAGACGAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-5314s21c1
Sequence:CCGGGTCGGGAACAGCGACATATTACTCGAGTAATATGTCGCTGTTCCCGACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-7552s21c1
Sequence:CCGGACGTTGGACTCCAACTAATTACTCGAGTAATTAGTTGGAGTCCAACGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-11523s21c1
Sequence:CCGGGCGCCGATCCGTGACTATAAACTCGAGTTTATAGTCACGGATCGGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-5301s1c1
Sequence:CCGGGCGACATATTATGGAAGAATTCTCGAGAATTCTTCCATAATATGTCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-905s1c1
Sequence:CCGGGCCATACAAATGTGGAATTAACTCGAGTTAATTCCACATTTGTATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-5818s1c1
Sequence:CCGGGCTGCATACAACTGTGCCATTCTCGAGAATGGCACAGTTGTATGCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-7898s1c1
Sequence:CCGGCCACCCAACAACAATATGATTCTCGAGAATCATATTGTTGTTGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-376s1c1
Sequence:CCGGCCAGCCTTAGACCTTCTGATTCTCGAGAATCAGAAGGTCTAAGGCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011159
PRKDC MISSION shRNA shRNA Plasmid DNA
protein kinase, DNA-activated, catalytic polypeptide
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-11904s21c1
Sequence:CCGGTTTCGTCTAACCCGCCAATTTCTCGAGAAATTGGCGGGTTAGACGAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-5314s21c1
Sequence:CCGGGTCGGGAACAGCGACATATTACTCGAGTAATATGTCGCTGTTCCCGACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-7552s21c1
Sequence:CCGGACGTTGGACTCCAACTAATTACTCGAGTAATTAGTTGGAGTCCAACGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-11523s21c1
Sequence:CCGGGCGCCGATCCGTGACTATAAACTCGAGTTTATAGTCACGGATCGGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-5301s1c1
Sequence:CCGGGCGACATATTATGGAAGAATTCTCGAGAATTCTTCCATAATATGTCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-905s1c1
Sequence:CCGGGCCATACAAATGTGGAATTAACTCGAGTTAATTCCACATTTGTATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-5818s1c1
Sequence:CCGGGCTGCATACAACTGTGCCATTCTCGAGAATGGCACAGTTGTATGCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-7898s1c1
Sequence:CCGGCCACCCAACAACAATATGATTCTCGAGAATCATATTGTTGTTGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000023860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-376s1c1
Sequence:CCGGCCAGCCTTAGACCTTCTGATTCTCGAGAATCAGAAGGTCTAAGGCTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011159
PRKDC MISSION shRNA Lentiviral Transduction Particles
protein kinase, DNA-activated, catalytic polypeptide
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-11904s21c1
Sequence:CCGGTTTCGTCTAACCCGCCAATTTCTCGAGAAATTGGCGGGTTAGACGAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-5314s21c1
Sequence:CCGGGTCGGGAACAGCGACATATTACTCGAGTAATATGTCGCTGTTCCCGACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361373    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-7552s21c1
Sequence:CCGGACGTTGGACTCCAACTAATTACTCGAGTAATTAGTTGGAGTCCAACGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368723    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011159.2-11523s21c1
Sequence:CCGGGCGCCGATCCGTGACTATAAACTCGAGTTTATAGTCACGGATCGGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023859    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-5301s1c1
Sequence:CCGGGCGACATATTATGGAAGAATTCTCGAGAATTCTTCCATAATATGTCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-905s1c1
Sequence:CCGGGCCATACAAATGTGGAATTAACTCGAGTTAATTCCACATTTGTATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-5818s1c1
Sequence:CCGGGCTGCATACAACTGTGCCATTCTCGAGAATGGCACAGTTGTATGCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023861    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-7898s1c1
Sequence:CCGGCCACCCAACAACAATATGATTCTCGAGAATCATATTGTTGTTGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000023860    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011159.1-376s1c1
Sequence:CCGGCCAGCCTTAGACCTTCTGATTCTCGAGAATCAGAAGGTCTAAGGCTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006904
PRKDC MISSION shRNA Bacterial Glycerol Stock
protein kinase, DNA-activated, catalytic polypeptide
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-12460s1c1
Sequence:CCGGGCAGATAGAAAGCATTACATTCTCGAGAATGTAATGCTTTCTATCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-6839s1c1
Sequence:CCGGCCGGTAAAGATCCTAATTCTACTCGAGTAGAATTAGGATCTTTACCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-8611s1c1
Sequence:CCGGCCACCCTTTGTCTCTTGTATTCTCGAGAATACAAGAGACAAAGGGTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-2412s1c1
Sequence:CCGGGCAGCCTTATTACAAAGACATCTCGAGATGTCTTTGTAATAAGGCTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-1724s1c1
Sequence:CCGGCCAGTGAAAGTCTGAATCATTCTCGAGAATGATTCAGACTTTCACTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-12761s1c1
Sequence:CCGGGAAACAGCTGTCTCCGTAAATCTCGAGATTTACGGAGACAGCTGTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-5062s1c1
Sequence:CCGGCCTGAAGTCTTTACAACATATCTCGAGATATGTTGTAAAGACTTCAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006904.6-279s1c1
Sequence:CCGGCAGTATTGAATTTCGTGAATGCTCGAGCATTCACGAAATTCAATACTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-6806s1c1
Sequence:CCGGCCATCCCTTATAGGTTAATATCTCGAGATATTAACCTATAAGGGATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-11447s1c1
Sequence:CCGGCCTCCAGGTTAGGATTAATTGCTCGAGCAATTAATCCTAACCTGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-13159s1c1
Sequence:CCGGGCATTGAATTTGGGATAACTTCTCGAGAAGTTATCCCAAATTCAATGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006904
PRKDC MISSION shRNA shRNA Plasmid DNA
protein kinase, DNA-activated, catalytic polypeptide
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-12460s1c1
Sequence:CCGGGCAGATAGAAAGCATTACATTCTCGAGAATGTAATGCTTTCTATCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-6839s1c1
Sequence:CCGGCCGGTAAAGATCCTAATTCTACTCGAGTAGAATTAGGATCTTTACCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-8611s1c1
Sequence:CCGGCCACCCTTTGTCTCTTGTATTCTCGAGAATACAAGAGACAAAGGGTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-2412s1c1
Sequence:CCGGGCAGCCTTATTACAAAGACATCTCGAGATGTCTTTGTAATAAGGCTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000006257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-1724s1c1
Sequence:CCGGCCAGTGAAAGTCTGAATCATTCTCGAGAATGATTCAGACTTTCACTGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000197152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-12761s1c1
Sequence:CCGGGAAACAGCTGTCTCCGTAAATCTCGAGATTTACGGAGACAGCTGTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-5062s1c1
Sequence:CCGGCCTGAAGTCTTTACAACATATCTCGAGATATGTTGTAAAGACTTCAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006904.6-279s1c1
Sequence:CCGGCAGTATTGAATTTCGTGAATGCTCGAGCATTCACGAAATTCAATACTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-6806s1c1
Sequence:CCGGCCATCCCTTATAGGTTAATATCTCGAGATATTAACCTATAAGGGATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-11447s1c1
Sequence:CCGGCCTCCAGGTTAGGATTAATTGCTCGAGCAATTAATCCTAACCTGGAGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-13159s1c1
Sequence:CCGGGCATTGAATTTGGGATAACTTCTCGAGAAGTTATCCCAAATTCAATGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006904
PRKDC MISSION shRNA Lentiviral Transduction Particles
protein kinase, DNA-activated, catalytic polypeptide
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006255    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-12460s1c1
Sequence:CCGGGCAGATAGAAAGCATTACATTCTCGAGAATGTAATGCTTTCTATCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-6839s1c1
Sequence:CCGGCCGGTAAAGATCCTAATTCTACTCGAGTAGAATTAGGATCTTTACCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-8611s1c1
Sequence:CCGGCCACCCTTTGTCTCTTGTATTCTCGAGAATACAAGAGACAAAGGGTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-2412s1c1
Sequence:CCGGGCAGCCTTATTACAAAGACATCTCGAGATGTCTTTGTAATAAGGCTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000006257    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-1724s1c1
Sequence:CCGGCCAGTGAAAGTCTGAATCATTCTCGAGAATGATTCAGACTTTCACTGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000197152    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-12761s1c1
Sequence:CCGGGAAACAGCTGTCTCCGTAAATCTCGAGATTTACGGAGACAGCTGTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-5062s1c1
Sequence:CCGGCCTGAAGTCTTTACAACATATCTCGAGATATGTTGTAAAGACTTCAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194811    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006904.6-279s1c1
Sequence:CCGGCAGTATTGAATTTCGTGAATGCTCGAGCATTCACGAAATTCAATACTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194985    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-6806s1c1
Sequence:CCGGCCATCCCTTATAGGTTAATATCTCGAGATATTAACCTATAAGGGATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006904.6-11447s1c1
Sequence:CCGGCCTCCAGGTTAGGATTAATTGCTCGAGCAATTAATCCTAACCTGGAGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006904.6-13159s1c1
Sequence:CCGGGCATTGAATTTGGGATAACTTCTCGAGAAGTTATCCCAAATTCAATGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)