EMAIL THIS PAGE TO A FRIEND

PRKG1

protein kinase, cGMP-dependent, type I

168 Gene Product Result for
Synonyms: 1 PKG PRKG1B PRKGR1B cGK cGK 1 cGK1 cGKI cGKI-BETA cGKI-alpha
UniProtKB ID: Q13976, E2PU10, P14619, Q5JSJ6, Q6P5T7
Gene ID:
Human(5592) Summary: Mammals have three different isoforms of cyclic GMP-dependent protein kinase (Ialpha, Ibeta, and II). These PRKG isoforms act as key mediators of the nitric oxide/cGMP signaling pathway and are important components of many signal transduction processes in diverse cell types. This PRKG1 gene on human chromosome 10 encodes the soluble Ialpha and Ibeta isoforms of PRKG by alternative transcript splicing. A separate gene on human chromosome 4, PRKG2, encodes the membrane-bound PRKG isoform II. The PRKG1 proteins play a central role in regulating cardiovascular and neuronal functions in addition to relaxing smooth muscle tone, preventing platelet aggregation, and modulating cell growth. This gene is most strongly expressed in all types of smooth muscle, platelets, cerebellar Purkinje cells, hippocampal neurons, and the lateral amygdala. Isoforms Ialpha and Ibeta have identical cGMP-binding and catalytic domains but differ in their leucine/isoleucine zipper and autoinhibitory sequences and therefore differ in their dimerization substrates and kinase enzyme activity. [provided by RefSeq, Sep 2011]
Mouse(19091) protein kinase, cGMP-dependent, type I
Rat(54286) protein kinase, cGMP-dependent, type 1
cow(282004) protein kinase, cGMP-dependent, type I
sheep(101117124) protein kinase, cGMP-dependent, type I
sheep(100294616) protein kinase, cGMP-dependent, type I
domestic guinea pig(100734084) protein kinase, cGMP-dependent, type I
Domestic Rabbit(100008694) protein kinase, cGMP-dependent, type I
naked mole-rat(101708361) protein kinase, cGMP-dependent, type I
chicken(423682) protein kinase, cGMP-dependent, type I
dog(609616) protein kinase, cGMP-dependent, type I
Horse(100071872) protein kinase, cGMP-dependent, type I
domestic cat(101097420) protein kinase, cGMP-dependent, type I
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011160 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011160 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011160 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006258 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098512 Rosetta Predictions human pricing
NM_006258 Rosetta Predictions human pricing
NM_001105731 Rosetta Predictions rat pricing
NM_001013833 Rosetta Predictions mouse pricing
NM_011160 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319187 predicted 759
2 SASI_Hs02_00319188 predicted 2081
3 SASI_Hs02_00319189 predicted 1543
4 SASI_Hs02_00319190 predicted 1112
5 SASI_Hs02_00319191 predicted 2264
6 SASI_Hs02_00319192 predicted 1795
7 SASI_Hs02_00319193 predicted 807
8 SASI_Hs02_00319194 predicted 919
9 SASI_Hs02_00319195 predicted 1127
10 SASI_Hs02_00319196 predicted 1446
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341203 predicted 724
2 SASI_Hs01_00122120 predicted 2044
3 SASI_Hs01_00122121 predicted 1509
4 SASI_Hs01_00122122 predicted 1085
5 SASI_Hs02_00341204 predicted 2238
6 SASI_Hs01_00122123 predicted 1760
7 SASI_Hs01_00122124 predicted 775
8 SASI_Hs01_00122125 predicted 893
9 SASI_Hs01_00122126 predicted 1101
10 SASI_Hs01_00122128 predicted 1409
11 SASI_Hs01_00122127 predicted 1825
12 SASI_Hs01_00122129 predicted 536
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105731 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211976 predicted 1265
2 SASI_Rn02_00211977 predicted 562
3 SASI_Rn02_00211978 predicted 1246
4 SASI_Rn02_00211979 predicted 498
5 SASI_Rn02_00211980 predicted 1152
6 SASI_Rn02_00211981 predicted 339
7 SASI_Rn02_00211982 predicted 849
8 SASI_Rn02_00211983 predicted 272
9 SASI_Rn02_00211984 predicted 1411
10 SASI_Rn02_00211985 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00117462 predicted 1031
2 SASI_Mm02_00287412 predicted 2059
3 SASI_Mm01_00117463 predicted 1453
4 SASI_Mm01_00117464 predicted 713
5 SASI_Mm02_00287413 predicted 1813
6 SASI_Mm01_00117466 predicted 1389
7 SASI_Mm01_00117467 predicted 1205
8 SASI_Mm01_00117469 predicted 939
9 SASI_Mm02_00287414 predicted 2102
10 SASI_Mm02_00287415 predicted 2197
11 SASI_Mm01_00117461 predicted 887
12 SASI_Mm01_00117465 predicted 1633
13 SASI_Mm01_00117468 predicted 1280
14 SASI_Mm01_00117470 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011160 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00182571 predicted 951
2 SASI_Mm02_00320025 predicted 1984
3 SASI_Mm01_00182572 predicted 1373
4 SASI_Mm01_00182573 predicted 633
5 SASI_Mm02_00320026 predicted 1732
6 SASI_Mm01_00182575 predicted 1312
7 SASI_Mm01_00182576 predicted 1125
8 SASI_Mm01_00182578 predicted 861
9 SASI_Mm02_00320027 predicted 2020
10 SASI_Mm02_00320028 predicted 2113
11 SASI_Mm01_00182570 predicted 815
12 SASI_Mm01_00182574 predicted 1555
13 SASI_Mm01_00182577 predicted 1205
14 SASI_Mm01_00182579 predicted 1380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011160
VALIDATED
PRKG1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, cGMP-dependent, type I
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000022779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011160.1-1593s1c1
Sequence:CCGGCCGGAGAATCTCATCCTAGATCTCGAGATCTAGGATGAGATTCTCCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-1121s1c1
Sequence:CCGGCGATGTTTCTAACAAAGCATACTCGAGTATGCTTTGTTAGAAACATCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-670s1c1
Sequence:CCGGCGACCGTCAAGACTCTTGTAACTCGAGTTACAAGAGTCTTGACGGTCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011160.1-1713s1c1
Sequence:CCGGCCAGAGATCATCCTGAACAAACTCGAGTTTGTTCAGGATGATCTCTGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000022780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-2034s1c1
Sequence:CCGGCCTCCCATAATTCCAAGTGTTCTCGAGAACACTTGGAATTATGGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-2026s21c1
Sequence:CCGGCCTTGACACCTCCCATAATTCCTCGAGGAATTATGGGAGGTGTCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-399s21c1
Sequence:CCGGCAGTCGAAGGATCTCATAAAGCTCGAGCTTTATGAGATCCTTCGACTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1558s21c1
Sequence:CCGGTGCATTCCAAAGGAATCATTTCTCGAGAAATGATTCCTTTGGAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1306s21c1
Sequence:CCGGTCCTCAAGAAACGCCACATTGCTCGAGCAATGTGGCGTTTCTTGAGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1085s21c1
Sequence:CCGGCAGAGACTCTTTCAAGCATTTCTCGAGAAATGCTTGAAAGAGTCTCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011160.2-2631s21c1
Sequence:CCGGGTACAACGAGGACCACATATCCTCGAGGATATGTGGTCCTCGTTGTACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000360701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011160.2-2431s21c1
Sequence:CCGGCCTTGCTTTGCTCTGATTATACTCGAGTATAATCAGAGCAAAGCAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011160
VALIDATED
PRKG1 MISSION shRNA shRNA Plasmid DNA
protein kinase, cGMP-dependent, type I
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000022779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011160.1-1593s1c1
Sequence:CCGGCCGGAGAATCTCATCCTAGATCTCGAGATCTAGGATGAGATTCTCCGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-1121s1c1
Sequence:CCGGCGATGTTTCTAACAAAGCATACTCGAGTATGCTTTGTTAGAAACATCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-670s1c1
Sequence:CCGGCGACCGTCAAGACTCTTGTAACTCGAGTTACAAGAGTCTTGACGGTCGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011160.1-1713s1c1
Sequence:CCGGCCAGAGATCATCCTGAACAAACTCGAGTTTGTTCAGGATGATCTCTGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000022780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-2034s1c1
Sequence:CCGGCCTCCCATAATTCCAAGTGTTCTCGAGAACACTTGGAATTATGGGAGGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-2026s21c1
Sequence:CCGGCCTTGACACCTCCCATAATTCCTCGAGGAATTATGGGAGGTGTCAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-399s21c1
Sequence:CCGGCAGTCGAAGGATCTCATAAAGCTCGAGCTTTATGAGATCCTTCGACTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1558s21c1
Sequence:CCGGTGCATTCCAAAGGAATCATTTCTCGAGAAATGATTCCTTTGGAATGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1306s21c1
Sequence:CCGGTCCTCAAGAAACGCCACATTGCTCGAGCAATGTGGCGTTTCTTGAGGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1085s21c1
Sequence:CCGGCAGAGACTCTTTCAAGCATTTCTCGAGAAATGCTTGAAAGAGTCTCTGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011160.2-2631s21c1
Sequence:CCGGGTACAACGAGGACCACATATCCTCGAGGATATGTGGTCCTCGTTGTACTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000360701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011160.2-2431s21c1
Sequence:CCGGCCTTGCTTTGCTCTGATTATACTCGAGTATAATCAGAGCAAAGCAAGGTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011160
VALIDATED
PRKG1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, cGMP-dependent, type I
Mouse
12 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000022779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011160.1-1593s1c1
Sequence:CCGGCCGGAGAATCTCATCCTAGATCTCGAGATCTAGGATGAGATTCTCCGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022783    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-1121s1c1
Sequence:CCGGCGATGTTTCTAACAAAGCATACTCGAGTATGCTTTGTTAGAAACATCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-670s1c1
Sequence:CCGGCGACCGTCAAGACTCTTGTAACTCGAGTTACAAGAGTCTTGACGGTCGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022781    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011160.1-1713s1c1
Sequence:CCGGCCAGAGATCATCCTGAACAAACTCGAGTTTGTTCAGGATGATCTCTGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000022780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011160.1-2034s1c1
Sequence:CCGGCCTCCCATAATTCCAAGTGTTCTCGAGAACACTTGGAATTATGGGAGGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-2026s21c1
Sequence:CCGGCCTTGACACCTCCCATAATTCCTCGAGGAATTATGGGAGGTGTCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360705    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-399s21c1
Sequence:CCGGCAGTCGAAGGATCTCATAAAGCTCGAGCTTTATGAGATCCTTCGACTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1558s21c1
Sequence:CCGGTGCATTCCAAAGGAATCATTTCTCGAGAAATGATTCCTTTGGAATGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1306s21c1
Sequence:CCGGTCCTCAAGAAACGCCACATTGCTCGAGCAATGTGGCGTTTCTTGAGGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360632    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011160.2-1085s21c1
Sequence:CCGGCAGAGACTCTTTCAAGCATTTCTCGAGAAATGCTTGAAAGAGTCTCTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360635    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011160.2-2631s21c1
Sequence:CCGGGTACAACGAGGACCACATATCCTCGAGGATATGTGGTCCTCGTTGTACTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000360701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011160.2-2431s21c1
Sequence:CCGGCCTTGCTTTGCTCTGATTATACTCGAGTATAATCAGAGCAAAGCAAGGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006258
VALIDATED
PRKG1 MISSION shRNA Bacterial Glycerol Stock
protein kinase, cGMP-dependent, type I
Human
21 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000055432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-883s1c2
Sequence:CCGGCATCAGCAAAGGAACGGTAAACTCGAGTTTACCGTTCCTTTGCTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-1348s1c1
Sequence:CCGGGGCTCATTCCGATTTCATAGTCTCGAGACTATGAAATCGGAATGAGCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006258.2-2633s21c1
Sequence:CCGGATTACTGCAGGCCGGTGTATACTCGAGTATACACCGGCCTGCAGTAATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-1378s1c1
Sequence:CCGGCAGAACATTTAAGGACAGCAACTCGAGTTGCTGTCCTTAAATGTTCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-1084s1c1
Sequence:CCGGGCTGGATGATGTTTCTAATAACTCGAGTTATTAGAAACATCATCCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000000996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-3498s1c1
Sequence:CCGGGTCCATATACTTGTCTAACTACTCGAGTAGTTAGACAAGTATATGGACTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-711s1c1
Sequence:CCGGGGACAGGACTCATCAAGCATACTCGAGTATGCTTGATGAGTCCTGTCCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-883s1c1
Sequence:CCGGCATCAGCAAAGGAACGGTAAACTCGAGTTTACCGTTCCTTTGCTGATGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000010030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-1740s1c1
Sequence:CCGGTCCTAATGTATGAACTCCTGACTCGAGTCAGGAGTTCATACATTAGGATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006258.1-2589s1c1
Sequence:CCGGCCGGTGTATATACCATACAAACTCGAGTTTGTATGGTATATACACCGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.1-2003s1c1
Sequence:CCGGCCTCCTATAATACCAAGTGTTCTCGAGAACACTTGGTATTATAGGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000195176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006258.1-3205s1c1
Sequence:CCGGCCTGTCCAATTTGACTTATACCTCGAGGTATAAGTCAAATTGGACAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000196847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.1-1171s1c1
Sequence:CCGGGCTGTCTGATTTCAACATCATCTCGAGATGATGTTGAAATCAGACAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-699s21c1
Sequence:CCGGGACCGTCAAGACTCTTGTAAACTCGAGTTTACAAGAGTCTTGACGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006258.2-2833s21c1
Sequence:CCGGACCTCTCATAGTAGGTATATACTCGAGTATATACCTACTATGAGAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-1650s21c1
Sequence:CCGGTTATGCCAAACTGGTTGATTTCTCGAGAAATCAACCAGTTTGGCATAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000256883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-1586s21c1
Sequence:CCGGTGCATTCCAAAGGAATCATTTCTCGAGAAATGATTCCTTTGGAATGCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000267652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-2150s21c1
Sequence:CCGGACAACTCAGGATGGGATATAGCTCGAGCTATATCCCATCCTGAGTTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.1-935s1c1
Sequence:CCGGCCAGTCTTTCTTAGAACTTTACTCGAGTAAAGTTCTAAGAAAGACTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-2053s21c1
Sequence:CCGGACCTTGACACCTCCTATAATACTCGAGTATTATAGGAGGTGTCAAGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000355918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-779s21c1
Sequence:CCGGTCATCAAGCATACCGAGTATACTCGAGTATACTCGGTATGCTTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006258
VALIDATED
PRKG1 MISSION shRNA shRNA Plasmid DNA
protein kinase, cGMP-dependent, type I
Human
21 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000055432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-883s1c2
Sequence:CCGGCATCAGCAAAGGAACGGTAAACTCGAGTTTACCGTTCCTTTGCTGATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-1348s1c1
Sequence:CCGGGGCTCATTCCGATTTCATAGTCTCGAGACTATGAAATCGGAATGAGCCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006258.2-2633s21c1
Sequence:CCGGATTACTGCAGGCCGGTGTATACTCGAGTATACACCGGCCTGCAGTAATTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-1378s1c1
Sequence:CCGGCAGAACATTTAAGGACAGCAACTCGAGTTGCTGTCCTTAAATGTTCTGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-1084s1c1
Sequence:CCGGGCTGGATGATGTTTCTAATAACTCGAGTTATTAGAAACATCATCCAGCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000000996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-3498s1c1
Sequence:CCGGGTCCATATACTTGTCTAACTACTCGAGTAGTTAGACAAGTATATGGACTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-711s1c1
Sequence:CCGGGGACAGGACTCATCAAGCATACTCGAGTATGCTTGATGAGTCCTGTCCTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-883s1c1
Sequence:CCGGCATCAGCAAAGGAACGGTAAACTCGAGTTTACCGTTCCTTTGCTGATGTTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000010030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-1740s1c1
Sequence:CCGGTCCTAATGTATGAACTCCTGACTCGAGTCAGGAGTTCATACATTAGGATTTTT
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006258.1-2589s1c1
Sequence:CCGGCCGGTGTATATACCATACAAACTCGAGTTTGTATGGTATATACACCGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.1-2003s1c1
Sequence:CCGGCCTCCTATAATACCAAGTGTTCTCGAGAACACTTGGTATTATAGGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000195176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006258.1-3205s1c1
Sequence:CCGGCCTGTCCAATTTGACTTATACCTCGAGGTATAAGTCAAATTGGACAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000196847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.1-1171s1c1
Sequence:CCGGGCTGTCTGATTTCAACATCATCTCGAGATGATGTTGAAATCAGACAGCTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-699s21c1
Sequence:CCGGGACCGTCAAGACTCTTGTAAACTCGAGTTTACAAGAGTCTTGACGGTCTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006258.2-2833s21c1
Sequence:CCGGACCTCTCATAGTAGGTATATACTCGAGTATATACCTACTATGAGAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-1650s21c1
Sequence:CCGGTTATGCCAAACTGGTTGATTTCTCGAGAAATCAACCAGTTTGGCATAATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000256883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-1586s21c1
Sequence:CCGGTGCATTCCAAAGGAATCATTTCTCGAGAAATGATTCCTTTGGAATGCATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000267652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-2150s21c1
Sequence:CCGGACAACTCAGGATGGGATATAGCTCGAGCTATATCCCATCCTGAGTTGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000194729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.1-935s1c1
Sequence:CCGGCCAGTCTTTCTTAGAACTTTACTCGAGTAAAGTTCTAAGAAAGACTGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-2053s21c1
Sequence:CCGGACCTTGACACCTCCTATAATACTCGAGTATTATAGGAGGTGTCAAGGTTTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
TRCN0000355918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-779s21c1
Sequence:CCGGTCATCAAGCATACCGAGTATACTCGAGTATACTCGGTATGCTTGATGATTTTTG
Availability: Usually ships in 2 - 3 weeks. (outside of the US and Europe, please allow additional 1-2 weeks for delivery
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006258
VALIDATED
PRKG1 MISSION shRNA Lentiviral Transduction Particles
protein kinase, cGMP-dependent, type I
Human
21 Products Total
TRC Number Volume Titer/mL Vector Price Set Price (5+)? Select
TRCN0000055432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-883s1c2
Sequence:CCGGCATCAGCAAAGGAACGGTAAACTCGAGTTTACCGTTCCTTTGCTGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-1348s1c1
Sequence:CCGGGGCTCATTCCGATTTCATAGTCTCGAGACTATGAAATCGGAATGAGCCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355919    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006258.2-2633s21c1
Sequence:CCGGATTACTGCAGGCCGGTGTATACTCGAGTATACACCGGCCTGCAGTAATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-1378s1c1
Sequence:CCGGCAGAACATTTAAGGACAGCAACTCGAGTTGCTGTCCTTAAATGTTCTGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-1084s1c1
Sequence:CCGGGCTGGATGATGTTTCTAATAACTCGAGTTATTAGAAACATCATCCAGCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000000996    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-3498s1c1
Sequence:CCGGGTCCATATACTTGTCTAACTACTCGAGTAGTTAGACAAGTATATGGACTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010032    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-711s1c1
Sequence:CCGGGGACAGGACTCATCAAGCATACTCGAGTATGCTTGATGAGTCCTGTCCTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.x-883s1c1
Sequence:CCGGCATCAGCAAAGGAACGGTAAACTCGAGTTTACCGTTCCTTTGCTGATGTTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000010030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.x-1740s1c1
Sequence:CCGGTCCTAATGTATGAACTCCTGACTCGAGTCAGGAGTTCATACATTAGGATTTTT
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194810    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006258.1-2589s1c1
Sequence:CCGGCCGGTGTATATACCATACAAACTCGAGTTTGTATGGTATATACACCGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.1-2003s1c1
Sequence:CCGGCCTCCTATAATACCAAGTGTTCTCGAGAACACTTGGTATTATAGGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000195176    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006258.1-3205s1c1
Sequence:CCGGCCTGTCCAATTTGACTTATACCTCGAGGTATAAGTCAAATTGGACAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000196847    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006258.1-1171s1c1
Sequence:CCGGGCTGTCTGATTTCAACATCATCTCGAGATGATGTTGAAATCAGACAGCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-699s21c1
Sequence:CCGGGACCGTCAAGACTCTTGTAAACTCGAGTTTACAAGAGTCTTGACGGTCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256885    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006258.2-2833s21c1
Sequence:CCGGACCTCTCATAGTAGGTATATACTCGAGTATATACCTACTATGAGAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-1650s21c1
Sequence:CCGGTTATGCCAAACTGGTTGATTTCTCGAGAAATCAACCAGTTTGGCATAATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000256883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-1586s21c1
Sequence:CCGGTGCATTCCAAAGGAATCATTTCTCGAGAAATGATTCCTTTGGAATGCATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000267652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-2150s21c1
Sequence:CCGGACAACTCAGGATGGGATATAGCTCGAGCTATATCCCATCCTGAGTTGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194729    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_006258.1-935s1c1
Sequence:CCGGCCAGTCTTTCTTAGAACTTTACTCGAGTAAAGTTCTAAGAAAGACTGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-2053s21c1
Sequence:CCGGACCTTGACACCTCCTATAATACTCGAGTATTATAGGAGGTGTCAAGGTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000355918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006258.2-779s21c1
Sequence:CCGGTCATCAAGCATACCGAGTATACTCGAGTATACTCGGTATGCTTGATGATTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)