EMAIL THIS PAGE TO A FRIEND

PRKRIR

protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)

104 Gene Product Result for
Synonyms: DAP4 P52rIPK THAP0 THAP12
UniProtKB ID: O43422, A8K728, Q17RY9, Q8WTW1, Q9Y3Z4
Gene ID:
Mouse(72981) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Rat(308845) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
cow(508969) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
sheep(101108951) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
domestic guinea pig(100717826) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Domestic Rabbit(100352054) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
chicken(428122) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Horse(100064157) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
domestic cat(101099831) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
dog(485182) protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028410 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028410 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028410 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004705 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004705 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004705 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004705 Rosetta Predictions human pricing
XM_001065056 Rosetta Predictions rat pricing
XM_218949 Rosetta Predictions rat pricing
NM_028410 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004705 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016964 predicted 823
2 SASI_Hs01_00016966 predicted 2103
3 SASI_Hs01_00016967 predicted 224
4 SASI_Hs01_00016968 predicted 1012
5 SASI_Hs01_00016969 predicted 2370
6 SASI_Hs02_00338156 predicted 1777
7 SASI_Hs02_00338157 predicted 1866
8 SASI_Hs02_00338158 predicted 2145
9 SASI_Hs01_00016971 predicted 2364
10 SASI_Hs01_00016972 predicted 2328
11 SASI_Hs01_00016965 predicted 1701
12 SASI_Hs01_00016970 predicted 1358
13 SASI_Hs01_00016973 predicted 1751
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065056 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00312729 predicted 1472
2 SASI_Rn02_00312730 predicted 931
3 SASI_Rn02_00312731 predicted 1400
4 SASI_Rn02_00312732 predicted 2419
5 SASI_Rn02_00312733 predicted 1745
6 SASI_Rn02_00312734 predicted 2392
7 SASI_Rn02_00312735 predicted 1248
8 SASI_Rn02_00312736 predicted 1446
9 SASI_Rn02_00312737 predicted 1550
10 SASI_Rn02_00312738 predicted 218
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218949 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378217 predicted 1495
2 SASI_Rn02_00378218 predicted 959
3 SASI_Rn02_00378219 predicted 1423
4 SASI_Rn02_00378220 predicted 2440
5 SASI_Rn02_00378221 predicted 1764
6 SASI_Rn02_00378222 predicted 2415
7 SASI_Rn02_00378223 predicted 1270
8 SASI_Rn02_00378224 predicted 1470
9 SASI_Rn02_00378225 predicted 1566
10 SASI_Rn02_00378226 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028410 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119601 predicted 1456
2 SASI_Mm01_00119602 predicted 2370
3 SASI_Mm01_00119603 predicted 903
4 SASI_Mm01_00119604 predicted 857
5 SASI_Mm01_00119605 predicted 1715
6 SASI_Mm01_00119606 predicted 1377
7 SASI_Mm01_00119607 predicted 2398
8 SASI_Mm01_00119608 predicted 1330
9 SASI_Mm01_00119609 predicted 1437
10 SASI_Mm02_00333802 predicted 1111
11 SASI_Mm01_00119610 predicted 1384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028410
PRKRIR MISSION shRNA Bacterial Glycerol Stock
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-911s21c1
Sequence:CCGGATGAAGCTGATGCGGAGATTTCTCGAGAAATCTCCGCATCAGCTTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-247s21c1
Sequence:CCGGCGGACAGTCCTTCGAGATAATCTCGAGATTATCTCGAAGGACTGTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-1387s21c1
Sequence:CCGGGTTAGGTGGAATAACTATATACTCGAGTATATAGTTATTCCACCTAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028410.1-2417s21c1
Sequence:CCGGTATTGGTAATCCACGTGTTTACTCGAGTAAACACGTGGATTACCAATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-2079s1c1
Sequence:CCGGCCCTGTGATGAAAGTTGAGAACTCGAGTTCTCAACTTTCATCACAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-203s1c1
Sequence:CCGGCCAAACACTTTGAGACCTCTACTCGAGTAGAGGTCTCAAAGTGTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-1768s1c1
Sequence:CCGGGAGCACATTATTCAGGAACTTCTCGAGAAGTTCCTGAATAATGTGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-1633s1c1
Sequence:CCGGGCCACAAATTTAGCAACCAAACTCGAGTTTGGTTGCTAAATTTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028410.1-2370s1c1
Sequence:CCGGCCAGATAATGACTTGCTGATACTCGAGTATCAGCAAGTCATTATCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028410
PRKRIR MISSION shRNA shRNA Plasmid DNA
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-911s21c1
Sequence:CCGGATGAAGCTGATGCGGAGATTTCTCGAGAAATCTCCGCATCAGCTTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-247s21c1
Sequence:CCGGCGGACAGTCCTTCGAGATAATCTCGAGATTATCTCGAAGGACTGTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-1387s21c1
Sequence:CCGGGTTAGGTGGAATAACTATATACTCGAGTATATAGTTATTCCACCTAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000361861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028410.1-2417s21c1
Sequence:CCGGTATTGGTAATCCACGTGTTTACTCGAGTAAACACGTGGATTACCAATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-2079s1c1
Sequence:CCGGCCCTGTGATGAAAGTTGAGAACTCGAGTTCTCAACTTTCATCACAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-203s1c1
Sequence:CCGGCCAAACACTTTGAGACCTCTACTCGAGTAGAGGTCTCAAAGTGTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-1768s1c1
Sequence:CCGGGAGCACATTATTCAGGAACTTCTCGAGAAGTTCCTGAATAATGTGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-1633s1c1
Sequence:CCGGGCCACAAATTTAGCAACCAAACTCGAGTTTGGTTGCTAAATTTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000088703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028410.1-2370s1c1
Sequence:CCGGCCAGATAATGACTTGCTGATACTCGAGTATCAGCAAGTCATTATCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028410
PRKRIR MISSION shRNA Lentiviral Transduction Particles
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-911s21c1
Sequence:CCGGATGAAGCTGATGCGGAGATTTCTCGAGAAATCTCCGCATCAGCTTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-247s21c1
Sequence:CCGGCGGACAGTCCTTCGAGATAATCTCGAGATTATCTCGAAGGACTGTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028410.1-1387s21c1
Sequence:CCGGGTTAGGTGGAATAACTATATACTCGAGTATATAGTTATTCCACCTAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000361861    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028410.1-2417s21c1
Sequence:CCGGTATTGGTAATCCACGTGTTTACTCGAGTAAACACGTGGATTACCAATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-2079s1c1
Sequence:CCGGCCCTGTGATGAAAGTTGAGAACTCGAGTTCTCAACTTTCATCACAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-203s1c1
Sequence:CCGGCCAAACACTTTGAGACCTCTACTCGAGTAGAGGTCTCAAAGTGTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-1768s1c1
Sequence:CCGGGAGCACATTATTCAGGAACTTCTCGAGAAGTTCCTGAATAATGTGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028410.1-1633s1c1
Sequence:CCGGGCCACAAATTTAGCAACCAAACTCGAGTTTGGTTGCTAAATTTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000088703    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028410.1-2370s1c1
Sequence:CCGGCCAGATAATGACTTGCTGATACTCGAGTATCAGCAAGTCATTATCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004705
VALIDATED
PRKRIR MISSION shRNA Bacterial Glycerol Stock
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000364474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004705.2-165s21c1
Sequence:CCGGTCGATTATGTGCCAAACATTTCTCGAGAAATGTTTGGCACATAATCGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2685s21c1
Sequence:CCGGCAATTGACCTTTGACTAATAGCTCGAGCTATTAGTCAAAGGTCAATTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-1384s21c1
Sequence:CCGGTATATAGCTGGCCGAGCATTTCTCGAGAAATGCTCGGCCAGCTATATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2102s21c1
Sequence:CCGGGAAAGCGTCTTAAAGCATATTCTCGAGAATATGCTTTAAGACGCTTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2342s21c1
Sequence:CCGGGGTGTATGTAGACCACTTAATCTCGAGATTAAGTGGTCTACATACACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-988s21c1
Sequence:CCGGTACATTGTCTCTAGTGGATTTCTCGAGAAATCCACTAGAGACAATGTATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004705.2-791s21c1
Sequence:CCGGCTGACGATGTAGTGGACATAGCTCGAGCTATGTCCACTACATCGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-609s21c1
Sequence:CCGGACTGCTGGAGTGTCGGATAAACTCGAGTTTATCCGACACTCCAGCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-829s1c1
Sequence:CCGGCCTGTGTTGGTGAGGTTTGTTCTCGAGAACAAACCTCACCAACACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-282s1c1
Sequence:CCGGCCCACATAGTAGACACAGAAACTCGAGTTTCTGTGTCTACTATGTGGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-2062s1c1
Sequence:CCGGCCTGTGATGAAGGTTGAGAATCTCGAGATTCTCAACCTTCATCACAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004705.2-1752s1c1
Sequence:CCGGGCACATTATTCAGGAACTTAACTCGAGTTAAGTTCCTGAATAATGTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004705.2-2404s1c1
Sequence:CCGGGCCATTGATAATCTACCTGTTCTCGAGAACAGGTAGATTATCAATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004705
VALIDATED
PRKRIR MISSION shRNA shRNA Plasmid DNA
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000364474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004705.2-165s21c1
Sequence:CCGGTCGATTATGTGCCAAACATTTCTCGAGAAATGTTTGGCACATAATCGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2685s21c1
Sequence:CCGGCAATTGACCTTTGACTAATAGCTCGAGCTATTAGTCAAAGGTCAATTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-1384s21c1
Sequence:CCGGTATATAGCTGGCCGAGCATTTCTCGAGAAATGCTCGGCCAGCTATATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2102s21c1
Sequence:CCGGGAAAGCGTCTTAAAGCATATTCTCGAGAATATGCTTTAAGACGCTTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2342s21c1
Sequence:CCGGGGTGTATGTAGACCACTTAATCTCGAGATTAAGTGGTCTACATACACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000364471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-988s21c1
Sequence:CCGGTACATTGTCTCTAGTGGATTTCTCGAGAAATCCACTAGAGACAATGTATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000368968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004705.2-791s21c1
Sequence:CCGGCTGACGATGTAGTGGACATAGCTCGAGCTATGTCCACTACATCGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000376478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-609s21c1
Sequence:CCGGACTGCTGGAGTGTCGGATAAACTCGAGTTTATCCGACACTCCAGCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-829s1c1
Sequence:CCGGCCTGTGTTGGTGAGGTTTGTTCTCGAGAACAAACCTCACCAACACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-282s1c1
Sequence:CCGGCCCACATAGTAGACACAGAAACTCGAGTTTCTGTGTCTACTATGTGGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-2062s1c1
Sequence:CCGGCCTGTGATGAAGGTTGAGAATCTCGAGATTCTCAACCTTCATCACAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004705.2-1752s1c1
Sequence:CCGGGCACATTATTCAGGAACTTAACTCGAGTTAAGTTCCTGAATAATGTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000005206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004705.2-2404s1c1
Sequence:CCGGGCCATTGATAATCTACCTGTTCTCGAGAACAGGTAGATTATCAATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004705
VALIDATED
PRKRIR MISSION shRNA Lentiviral Transduction Particles
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor, repressor of (P58 repressor)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000364474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004705.2-165s21c1
Sequence:CCGGTCGATTATGTGCCAAACATTTCTCGAGAAATGTTTGGCACATAATCGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364418    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2685s21c1
Sequence:CCGGCAATTGACCTTTGACTAATAGCTCGAGCTATTAGTCAAAGGTCAATTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-1384s21c1
Sequence:CCGGTATATAGCTGGCCGAGCATTTCTCGAGAAATGCTCGGCCAGCTATATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368966    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2102s21c1
Sequence:CCGGGAAAGCGTCTTAAAGCATATTCTCGAGAATATGCTTTAAGACGCTTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368967    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-2342s21c1
Sequence:CCGGGGTGTATGTAGACCACTTAATCTCGAGATTAAGTGGTCTACATACACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000364471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-988s21c1
Sequence:CCGGTACATTGTCTCTAGTGGATTTCTCGAGAAATCCACTAGAGACAATGTATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000368968    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004705.2-791s21c1
Sequence:CCGGCTGACGATGTAGTGGACATAGCTCGAGCTATGTCCACTACATCGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000376478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004705.2-609s21c1
Sequence:CCGGACTGCTGGAGTGTCGGATAAACTCGAGTTTATCCGACACTCCAGCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-829s1c1
Sequence:CCGGCCTGTGTTGGTGAGGTTTGTTCTCGAGAACAAACCTCACCAACACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-282s1c1
Sequence:CCGGCCCACATAGTAGACACAGAAACTCGAGTTTCTGTGTCTACTATGTGGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004705.2-2062s1c1
Sequence:CCGGCCTGTGATGAAGGTTGAGAATCTCGAGATTCTCAACCTTCATCACAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005209    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004705.2-1752s1c1
Sequence:CCGGGCACATTATTCAGGAACTTAACTCGAGTTAAGTTCCTGAATAATGTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000005206    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004705.2-2404s1c1
Sequence:CCGGGCCATTGATAATCTACCTGTTCTCGAGAACAGGTAGATTATCAATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)