EMAIL THIS PAGE TO A FRIEND

PRL

prolactin

69 Gene Product Result for
UniProtKB ID: P01236, Q15199, Q92996
Gene ID:
Human(5617) Summary: This gene encodes the anterior pituitary hormone prolactin. This secreted hormone is a growth regulator for many tissues, including cells of the immune system. It may also play a role in cell survival by suppressing apoptosis, and it is essential for lactation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Aug 2011]
Mouse(19109) prolactin
Rat(24683) prolactin
fruit fly(48569) Proxless
dog(488241) prolactin
Horse(100034034) prolactin
chicken(396453) prolactin
Zebrafish(791526) prolactin
Thale Cress(828153) protein PROLIFERA
cow(280901) prolactin
sheep(443317) prolactin
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
B2134 2-Bromo-α-ergocryptine methanesulfonate salt solid human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000948 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000948 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000948 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011164 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011164 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011164 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000948 Rosetta Predictions human pricing
NM_012629 Rosetta Predictions rat pricing
NM_011164 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182212 predicted 709
2 SASI_Hs01_00182213 predicted 685
3 SASI_Hs01_00182214 predicted 874
4 SASI_Hs01_00182215 predicted 1124
5 SASI_Hs01_00182216 predicted 700
6 SASI_Hs01_00182218 predicted 845
7 SASI_Hs01_00182219 predicted 933
8 SASI_Hs01_00182220 predicted 674
9 SASI_Hs02_00303560 predicted 521
10 SASI_Hs01_00182221 predicted 1083
11 SASI_Hs01_00182217 predicted 1105
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080529 predicted 723
2 SASI_Rn01_00080533 predicted 634
3 SASI_Rn01_00080534 predicted 594
4 SASI_Rn01_00080537 predicted 444
5 SASI_Rn01_00080531 predicted 689
6 SASI_Rn02_00259851 predicted 346
7 SASI_Rn01_00080532 predicted 470
8 SASI_Rn02_00259852 predicted 212
9 SASI_Rn02_00259853 predicted 344
10 SASI_Rn02_00259854 predicted 599
11 SASI_Rn01_00080530 predicted 534
12 SASI_Rn01_00080535 predicted 700
13 SASI_Rn01_00080536 predicted 679
14 SASI_Rn01_00080538 predicted 473
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011164 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00037063 predicted 398
2 SASI_Mm01_00037064 predicted 353
3 SASI_Mm01_00037065 predicted 210
4 SASI_Mm01_00037066 predicted 216
5 SASI_Mm01_00037067 predicted 320
6 SASI_Mm01_00037068 predicted 562
7 SASI_Mm01_00037069 predicted 218
8 SASI_Mm01_00037070 predicted 544
9 SASI_Mm01_00037071 predicted 594
10 SASI_Mm01_00037072 predicted 582
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000948
PRL MISSION shRNA Bacterial Glycerol Stock
prolactin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-719s1c1
Sequence:CCGGGCGAATTCGATAAACGGTATACTCGAGTATACCGTTTATCGAATTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-1176s1c1
Sequence:CCGGGTGCCGAATCATCCACAACAACTCGAGTTGTTGTGGATGATTCGGCACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-931s1c1
Sequence:CCGGCCGGAGGCTATCCTATCCAAACTCGAGTTTGGATAGGATAGCCTCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-693s1c1
Sequence:CCGGCCATAACCTCTCCTCAGAAATCTCGAGATTTCTGAGGAGAGGTTATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-1094s1c1
Sequence:CCGGCTCGCCTTTCTGCTTATTATACTCGAGTATAATAAGCAGAAAGGCGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-641s21c1
Sequence:CCGGTGACCCTTCGAGACCTGTTTGCTCGAGCAAACAGGTCTCGAAGGGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-1125s21c1
Sequence:CCGGCCTACGCAGGGATTCACATAACTCGAGTTATGTGAATCCCTGCGTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-846s21c1
Sequence:CCGGGAGCCTGATAGTCAGCATATTCTCGAGAATATGCTGACTATCAGGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000948
PRL MISSION shRNA shRNA Plasmid DNA
prolactin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-719s1c1
Sequence:CCGGGCGAATTCGATAAACGGTATACTCGAGTATACCGTTTATCGAATTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-1176s1c1
Sequence:CCGGGTGCCGAATCATCCACAACAACTCGAGTTGTTGTGGATGATTCGGCACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-931s1c1
Sequence:CCGGCCGGAGGCTATCCTATCCAAACTCGAGTTTGGATAGGATAGCCTCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-693s1c1
Sequence:CCGGCCATAACCTCTCCTCAGAAATCTCGAGATTTCTGAGGAGAGGTTATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000058664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-1094s1c1
Sequence:CCGGCTCGCCTTTCTGCTTATTATACTCGAGTATAATAAGCAGAAAGGCGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-641s21c1
Sequence:CCGGTGACCCTTCGAGACCTGTTTGCTCGAGCAAACAGGTCTCGAAGGGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-1125s21c1
Sequence:CCGGCCTACGCAGGGATTCACATAACTCGAGTTATGTGAATCCCTGCGTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-846s21c1
Sequence:CCGGGAGCCTGATAGTCAGCATATTCTCGAGAATATGCTGACTATCAGGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000948
PRL MISSION shRNA Lentiviral Transduction Particles
prolactin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058663    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-719s1c1
Sequence:CCGGGCGAATTCGATAAACGGTATACTCGAGTATACCGTTTATCGAATTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058666    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-1176s1c1
Sequence:CCGGGTGCCGAATCATCCACAACAACTCGAGTTGTTGTGGATGATTCGGCACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058667    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-931s1c1
Sequence:CCGGCCGGAGGCTATCCTATCCAAACTCGAGTTTGGATAGGATAGCCTCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058665    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-693s1c1
Sequence:CCGGCCATAACCTCTCCTCAGAAATCTCGAGATTTCTGAGGAGAGGTTATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000058664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000948.2-1094s1c1
Sequence:CCGGCTCGCCTTTCTGCTTATTATACTCGAGTATAATAAGCAGAAAGGCGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-641s21c1
Sequence:CCGGTGACCCTTCGAGACCTGTTTGCTCGAGCAAACAGGTCTCGAAGGGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373246    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-1125s21c1
Sequence:CCGGCCTACGCAGGGATTCACATAACTCGAGTTATGTGAATCCCTGCGTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373297    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000948.4-846s21c1
Sequence:CCGGGAGCCTGATAGTCAGCATATTCTCGAGAATATGCTGACTATCAGGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011164
PRL MISSION shRNA Bacterial Glycerol Stock
prolactin
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-102s1c1
Sequence:CCGGGCTGATATCAAACCTGCTGTTCTCGAGAACAGCAGGTTTGATATCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-325s1c1
Sequence:CCGGGCTACACCTGAAGACAAGGAACTCGAGTTCCTTGTCTTCAGGTGTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-412s1c1
Sequence:CCGGGACCCTCTGTTTCAACTAATACTCGAGTATTAGTTGAAACAGAGGGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-666s1c1
Sequence:CCGGGCATTCCCACAAGGTTGACAACTCGAGTTGTCAACCTTGTGGGAATGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-482s1c1
Sequence:CCGGCCAAAGAGATTGAGGAACAAACTCGAGTTTGTTCCTCAATCTCTTTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011164
PRL MISSION shRNA shRNA Plasmid DNA
prolactin
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-102s1c1
Sequence:CCGGGCTGATATCAAACCTGCTGTTCTCGAGAACAGCAGGTTTGATATCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-325s1c1
Sequence:CCGGGCTACACCTGAAGACAAGGAACTCGAGTTCCTTGTCTTCAGGTGTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-412s1c1
Sequence:CCGGGACCCTCTGTTTCAACTAATACTCGAGTATTAGTTGAAACAGAGGGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-666s1c1
Sequence:CCGGGCATTCCCACAAGGTTGACAACTCGAGTTGTCAACCTTGTGGGAATGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-482s1c1
Sequence:CCGGCCAAAGAGATTGAGGAACAAACTCGAGTTTGTTCCTCAATCTCTTTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011164
PRL MISSION shRNA Lentiviral Transduction Particles
prolactin
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-102s1c1
Sequence:CCGGGCTGATATCAAACCTGCTGTTCTCGAGAACAGCAGGTTTGATATCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065889    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-325s1c1
Sequence:CCGGGCTACACCTGAAGACAAGGAACTCGAGTTCCTTGTCTTCAGGTGTAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-412s1c1
Sequence:CCGGGACCCTCTGTTTCAACTAATACTCGAGTATTAGTTGAAACAGAGGGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-666s1c1
Sequence:CCGGGCATTCCCACAAGGTTGACAACTCGAGTTGTCAACCTTGTGGGAATGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011164.1-482s1c1
Sequence:CCGGCCAAAGAGATTGAGGAACAAACTCGAGTTTGTTCCTCAATCTCTTTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)