EMAIL THIS PAGE TO A FRIEND

PRLH

prolactin releasing hormone

46 Gene Product Result for
Synonyms: PRH PRRP
UniProtKB ID: P81277
Gene ID:
Mouse(623503) prolactin releasing hormone
Rat(63850) prolactin releasing hormone
naked mole-rat(101699813) prolactin releasing hormone
cow(286856) prolactin releasing hormone
sheep(101110898) prolactin releasing hormone
sheep(443466) prolactin releasing hormone
Zebrafish(100536871) prolactin releasing hormone
dog(607110) prolactin releasing hormone
chicken(424018) prolactin releasing hormone
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015893 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015893 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015893 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001101647 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001101647 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001101647 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015893 Rosetta Predictions human pricing
NM_022222 Rosetta Predictions rat pricing
NM_001101647 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00149840 predicted 70
2 SASI_Hs01_00149841 predicted 67
3 SASI_Hs01_00149842 predicted 53
4 SASI_Hs01_00149843 predicted 71
5 SASI_Hs01_00149844 predicted 103
6 SASI_Hs01_00149845 predicted 137
7 SASI_Hs01_00149846 predicted 234
8 SASI_Hs01_00149847 predicted 139
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022222 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032918 predicted 69
2 SASI_Rn01_00032922 predicted 73
3 SASI_Rn01_00032923 predicted 208
4 SASI_Rn01_00032924 predicted 17
5 SASI_Rn01_00032926 predicted 15
6 SASI_Rn02_00262981 predicted 100
7 SASI_Rn02_00262982 predicted 20
8 SASI_Rn02_00262983 predicted 203
9 SASI_Rn02_00262984 predicted 12
10 SASI_Rn02_00262985 predicted 194
11 SASI_Rn01_00032917 predicted 146
12 SASI_Rn01_00032919 predicted 73
13 SASI_Rn01_00032920 predicted 179
14 SASI_Rn01_00032921 predicted 139
15 SASI_Rn01_00032925 predicted 144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001101647 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302644 predicted 206
2 SASI_Mm02_00302645 predicted 192
3 SASI_Mm02_00302646 predicted 201
4 SASI_Mm02_00302647 predicted 24
5 SASI_Mm02_00302648 predicted 226
6 SASI_Mm02_00302649 predicted 160
7 SASI_Mm02_00302650 predicted 62
8 SASI_Mm02_00302651 predicted 134
9 SASI_Mm02_00302652 predicted 12
10 SASI_Mm02_00302653 predicted 18
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015893
PRLH MISSION shRNA Bacterial Glycerol Stock
prolactin releasing hormone
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-105s1c1
Sequence:CCGGTGACATCAATCCTGCCTGGTACTCGAGTACCAGGCAGGATTGATGTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-59s1c1
Sequence:CCGGGAGCTGCAAGTCGTACCCATCCTCGAGGATGGGTACGACTTGCAGCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-75s1c1
Sequence:CCGGCCATCGGCACTCCATGGAGATCTCGAGATCTCCATGGAGTGCCGATGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-104s1c1
Sequence:CCGGCTGACATCAATCCTGCCTGGTCTCGAGACCAGGCAGGATTGATGTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-65s1c1
Sequence:CCGGCAAGTCGTACCCATCGGCACTCTCGAGAGTGCCGATGGGTACGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015893
PRLH MISSION shRNA shRNA Plasmid DNA
prolactin releasing hormone
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-105s1c1
Sequence:CCGGTGACATCAATCCTGCCTGGTACTCGAGTACCAGGCAGGATTGATGTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-59s1c1
Sequence:CCGGGAGCTGCAAGTCGTACCCATCCTCGAGGATGGGTACGACTTGCAGCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-75s1c1
Sequence:CCGGCCATCGGCACTCCATGGAGATCTCGAGATCTCCATGGAGTGCCGATGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-104s1c1
Sequence:CCGGCTGACATCAATCCTGCCTGGTCTCGAGACCAGGCAGGATTGATGTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000118110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-65s1c1
Sequence:CCGGCAAGTCGTACCCATCGGCACTCTCGAGAGTGCCGATGGGTACGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015893
PRLH MISSION shRNA Lentiviral Transduction Particles
prolactin releasing hormone
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-105s1c1
Sequence:CCGGTGACATCAATCCTGCCTGGTACTCGAGTACCAGGCAGGATTGATGTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-59s1c1
Sequence:CCGGGAGCTGCAAGTCGTACCCATCCTCGAGGATGGGTACGACTTGCAGCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-75s1c1
Sequence:CCGGCCATCGGCACTCCATGGAGATCTCGAGATCTCCATGGAGTGCCGATGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-104s1c1
Sequence:CCGGCTGACATCAATCCTGCCTGGTCTCGAGACCAGGCAGGATTGATGTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000118110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015893.1-65s1c1
Sequence:CCGGCAAGTCGTACCCATCGGCACTCTCGAGAGTGCCGATGGGTACGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001101647
PRLH MISSION shRNA Bacterial Glycerol Stock
prolactin releasing hormone
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-240s21c1
Sequence:CCGGCAAGTTCTCTCACAGCTCATGCTCGAGCATGAGCTGTGAGAGAACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-105s21c1
Sequence:CCGGCATCAATCCTGCCTGGTACACCTCGAGGTGTACCAGGCAGGATTGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-42s21c1
Sequence:CCGGCTTAGTCCTCCCAGGAGCTTCCTCGAGGAAGCTCCTGGGAGGACTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-27s21c1
Sequence:CCGGCTTGCTGCTGCTAGGCTTAGTCTCGAGACTAAGCCTAGCAGCAGCAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-227s21c1
Sequence:CCGGTGGATGGAAGTGCCAAGTTCTCTCGAGAGAACTTGGCACTTCCATCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001101647
PRLH MISSION shRNA shRNA Plasmid DNA
prolactin releasing hormone
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-240s21c1
Sequence:CCGGCAAGTTCTCTCACAGCTCATGCTCGAGCATGAGCTGTGAGAGAACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-105s21c1
Sequence:CCGGCATCAATCCTGCCTGGTACACCTCGAGGTGTACCAGGCAGGATTGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-42s21c1
Sequence:CCGGCTTAGTCCTCCCAGGAGCTTCCTCGAGGAAGCTCCTGGGAGGACTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-27s21c1
Sequence:CCGGCTTGCTGCTGCTAGGCTTAGTCTCGAGACTAAGCCTAGCAGCAGCAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000255150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-227s21c1
Sequence:CCGGTGGATGGAAGTGCCAAGTTCTCTCGAGAGAACTTGGCACTTCCATCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001101647
PRLH MISSION shRNA Lentiviral Transduction Particles
prolactin releasing hormone
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255149    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-240s21c1
Sequence:CCGGCAAGTTCTCTCACAGCTCATGCTCGAGCATGAGCTGTGAGAGAACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255147    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-105s21c1
Sequence:CCGGCATCAATCCTGCCTGGTACACCTCGAGGTGTACCAGGCAGGATTGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-42s21c1
Sequence:CCGGCTTAGTCCTCCCAGGAGCTTCCTCGAGGAAGCTCCTGGGAGGACTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255151    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-27s21c1
Sequence:CCGGCTTGCTGCTGCTAGGCTTAGTCTCGAGACTAAGCCTAGCAGCAGCAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000255150    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001101647.1-227s21c1
Sequence:CCGGTGGATGGAAGTGCCAAGTTCTCTCGAGAGAACTTGGCACTTCCATCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)