EMAIL THIS PAGE TO A FRIEND

PRLHR

prolactin releasing hormone receptor

72 Gene Product Result for
Synonyms: GPR10 GR3 PrRPR
UniProtKB ID: P49683, O75194, Q502U8, Q5VXR9
Gene ID:
Human(2834) Summary: PRLHR is a 7-transmembrane domain receptor for prolactin-releasing hormone (PRLH; MIM 602663) that is highly expressed in anterior pituitary (Ozawa et al., 2002 [PubMed 11923475]
Mouse(226278) prolactin releasing hormone receptor
Rat(246075) prolactin releasing hormone receptor
chicken(428985) prolactin releasing hormone receptor
dog(486911) prolactin releasing hormone receptor
domestic cat(101087527) prolactin releasing hormone receptor
cow(510397) prolactin releasing hormone receptor
sheep(100145860) prolactin releasing hormone receptor
naked mole-rat(101722716) prolactin releasing hormone receptor
domestic guinea pig(100717991) prolactin releasing hormone receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004248 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004248 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004248 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201615 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201615 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201615 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU003691 MISSION® esiRNA esiRNA targeting mouse Prlhr (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004248 Rosetta Predictions human pricing
NM_139193 Rosetta Predictions rat pricing
NM_201615 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004248 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337185 predicted 1642
2 SASI_Hs02_00337186 predicted 1705
3 SASI_Hs02_00337187 predicted 1351
4 SASI_Hs01_00136912 predicted 612
5 SASI_Hs01_00136914 predicted 727
6 SASI_Hs01_00136915 predicted 421
7 SASI_Hs02_00337188 predicted 1712
8 SASI_Hs02_00337189 predicted 1396
9 SASI_Hs02_00337190 predicted 313
10 SASI_Hs01_00136917 predicted 563
11 SASI_Hs01_00136913 predicted 313
12 SASI_Hs01_00136916 predicted 427
13 SASI_Hs01_00136918 predicted 717
14 SASI_Hs01_00136919 predicted 727
15 SASI_Hs01_00136920 predicted 233
16 SASI_Hs01_00136921 predicted 318
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058478 predicted 1106
2 SASI_Rn01_00058479 predicted 1185
3 SASI_Rn01_00058481 predicted 471
4 SASI_Rn01_00058482 predicted 442
5 SASI_Rn01_00058483 predicted 295
6 SASI_Rn01_00058484 predicted 522
7 SASI_Rn01_00058485 predicted 487
8 SASI_Rn02_00268523 predicted 454
9 SASI_Rn01_00058486 predicted 672
10 SASI_Rn01_00058487 predicted 1126
11 SASI_Rn01_00058480 predicted 1119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201615 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158269 predicted 616
2 SASI_Mm01_00158270 predicted 1287
3 SASI_Mm01_00158271 predicted 1132
4 SASI_Mm01_00158272 predicted 659
5 SASI_Mm01_00158273 predicted 500
6 SASI_Mm01_00158274 predicted 644
7 SASI_Mm01_00158275 predicted 412
8 SASI_Mm01_00158276 predicted 686
9 SASI_Mm01_00158277 predicted 563
10 SASI_Mm01_00158278 predicted 908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004248
PRLHR MISSION shRNA Bacterial Glycerol Stock
prolactin releasing hormone receptor
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000368464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004248.2-1739s21c1
Sequence:CCGGCCTAGAATTTCAGGTAAATATCTCGAGATATTTACCTGAAATTCTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004248.2-1356s21c1
Sequence:CCGGAGCCAACATAGGGCAACATTTCTCGAGAAATGTTGCCCTATGTTGGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-1217s21c1
Sequence:CCGGCATGGCCAGAATATGACCGTCCTCGAGGACGGTCATATTCTGGCCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-854s21c1
Sequence:CCGGCTGGTCATCCTCCTGTCTTACCTCGAGGTAAGACAGGAGGATGACCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-1243s21c1
Sequence:CCGGGGTCATCTGATGCCACTTAGCCTCGAGGCTAAGTGGCATCAGATGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-723s1c1
Sequence:CCGGCCTCCTGTCTTACGTCCGGGTCTCGAGACCCGGACGTAAGACAGGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-621s1c1
Sequence:CCGGCGTGCGCCTCTGCGAGGAGTTCTCGAGAACTCCTCGCAGAGGCGCACGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-276s1c1
Sequence:CCGGCAACGTGACGAACTTCCTCATCTCGAGATGAGGAAGTTCGTCACGTTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-429s1c1
Sequence:CCGGCACCGTCTATGTGTCGGTGTTCTCGAGAACACCGACACATAGACGGTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-919s1c1
Sequence:CCGGGCCATCGACCCTTACGCCTTTCTCGAGAAAGGCGTAAGGGTCGATGGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004248
PRLHR MISSION shRNA shRNA Plasmid DNA
prolactin releasing hormone receptor
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000368464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004248.2-1739s21c1
Sequence:CCGGCCTAGAATTTCAGGTAAATATCTCGAGATATTTACCTGAAATTCTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004248.2-1356s21c1
Sequence:CCGGAGCCAACATAGGGCAACATTTCTCGAGAAATGTTGCCCTATGTTGGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-1217s21c1
Sequence:CCGGCATGGCCAGAATATGACCGTCCTCGAGGACGGTCATATTCTGGCCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-854s21c1
Sequence:CCGGCTGGTCATCCTCCTGTCTTACCTCGAGGTAAGACAGGAGGATGACCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000357096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-1243s21c1
Sequence:CCGGGGTCATCTGATGCCACTTAGCCTCGAGGCTAAGTGGCATCAGATGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-723s1c1
Sequence:CCGGCCTCCTGTCTTACGTCCGGGTCTCGAGACCCGGACGTAAGACAGGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-621s1c1
Sequence:CCGGCGTGCGCCTCTGCGAGGAGTTCTCGAGAACTCCTCGCAGAGGCGCACGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-276s1c1
Sequence:CCGGCAACGTGACGAACTTCCTCATCTCGAGATGAGGAAGTTCGTCACGTTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-429s1c1
Sequence:CCGGCACCGTCTATGTGTCGGTGTTCTCGAGAACACCGACACATAGACGGTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000011501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-919s1c1
Sequence:CCGGGCCATCGACCCTTACGCCTTTCTCGAGAAAGGCGTAAGGGTCGATGGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004248
PRLHR MISSION shRNA Lentiviral Transduction Particles
prolactin releasing hormone receptor
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000368464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004248.2-1739s21c1
Sequence:CCGGCCTAGAATTTCAGGTAAATATCTCGAGATATTTACCTGAAATTCTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357094    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004248.2-1356s21c1
Sequence:CCGGAGCCAACATAGGGCAACATTTCTCGAGAAATGTTGCCCTATGTTGGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357095    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-1217s21c1
Sequence:CCGGCATGGCCAGAATATGACCGTCCTCGAGGACGGTCATATTCTGGCCATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-854s21c1
Sequence:CCGGCTGGTCATCCTCCTGTCTTACCTCGAGGTAAGACAGGAGGATGACCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000357096    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004248.2-1243s21c1
Sequence:CCGGGGTCATCTGATGCCACTTAGCCTCGAGGCTAAGTGGCATCAGATGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-723s1c1
Sequence:CCGGCCTCCTGTCTTACGTCCGGGTCTCGAGACCCGGACGTAAGACAGGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-621s1c1
Sequence:CCGGCGTGCGCCTCTGCGAGGAGTTCTCGAGAACTCCTCGCAGAGGCGCACGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-276s1c1
Sequence:CCGGCAACGTGACGAACTTCCTCATCTCGAGATGAGGAAGTTCGTCACGTTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-429s1c1
Sequence:CCGGCACCGTCTATGTGTCGGTGTTCTCGAGAACACCGACACATAGACGGTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000011501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004248.1-919s1c1
Sequence:CCGGGCCATCGACCCTTACGCCTTTCTCGAGAAAGGCGTAAGGGTCGATGGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201615
PRLHR MISSION shRNA Bacterial Glycerol Stock
prolactin releasing hormone receptor
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-631s21c1
Sequence:CCGGGTGTTCACACTCACCACAATCCTCGAGGATTGTGGTGAGTGTGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-533s21c1
Sequence:CCGGTCACGCTGGCTTATGCCTTTGCTCGAGCAAAGGCATAAGCCAGCGTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-918s21c1
Sequence:CCGGTTACGTACGGGTGTCAGTGAACTCGAGTTCACTGACACCCGTACGTAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201615.1-1351s21c1
Sequence:CCGGGGTCGTCGTGAGATCTTATTCCTCGAGGAATAAGATCTCACGACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-870s21c1
Sequence:CCGGGCTGCTTCTGGGCACCTATTTCTCGAGAAATAGGTGCCCAGAAGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201615.1-1362s1c1
Sequence:CCGGGATCTTATTCCCAGCACCAAACTCGAGTTTGGTGCTGGGAATAAGATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201615
PRLHR MISSION shRNA shRNA Plasmid DNA
prolactin releasing hormone receptor
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-631s21c1
Sequence:CCGGGTGTTCACACTCACCACAATCCTCGAGGATTGTGGTGAGTGTGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-533s21c1
Sequence:CCGGTCACGCTGGCTTATGCCTTTGCTCGAGCAAAGGCATAAGCCAGCGTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-918s21c1
Sequence:CCGGTTACGTACGGGTGTCAGTGAACTCGAGTTCACTGACACCCGTACGTAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201615.1-1351s21c1
Sequence:CCGGGGTCGTCGTGAGATCTTATTCCTCGAGGAATAAGATCTCACGACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000241762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-870s21c1
Sequence:CCGGGCTGCTTCTGGGCACCTATTTCTCGAGAAATAGGTGCCCAGAAGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000194438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201615.1-1362s1c1
Sequence:CCGGGATCTTATTCCCAGCACCAAACTCGAGTTTGGTGCTGGGAATAAGATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201615
PRLHR MISSION shRNA Lentiviral Transduction Particles
prolactin releasing hormone receptor
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-631s21c1
Sequence:CCGGGTGTTCACACTCACCACAATCCTCGAGGATTGTGGTGAGTGTGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-533s21c1
Sequence:CCGGTCACGCTGGCTTATGCCTTTGCTCGAGCAAAGGCATAAGCCAGCGTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-918s21c1
Sequence:CCGGTTACGTACGGGTGTCAGTGAACTCGAGTTCACTGACACCCGTACGTAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241763    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_201615.1-1351s21c1
Sequence:CCGGGGTCGTCGTGAGATCTTATTCCTCGAGGAATAAGATCTCACGACGACCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000241762    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_201615.1-870s21c1
Sequence:CCGGGCTGCTTCTGGGCACCTATTTCTCGAGAAATAGGTGCCCAGAAGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000194438    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_201615.1-1362s1c1
Sequence:CCGGGATCTTATTCCCAGCACCAAACTCGAGTTTGGTGCTGGGAATAAGATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)