EMAIL THIS PAGE TO A FRIEND

PRLR

prolactin receptor

73 Gene Product Result for
Synonyms: hPRLrI
Gene ID:
Human(5618) Summary: This gene encodes a receptor for the anterior pituitary hormone, prolactin, and belongs to the type I cytokine receptor family. Prolactin-dependent signaling occurs as the result of ligand-induced dimerization of the prolactin receptor. Several alternatively spliced transcript variants encoding different membrane-bound and soluble isoforms have been described for this gene, which may function to modulate the endocrine and autocrine effects of prolactin in normal tissue and cancer. [provided by RefSeq, Feb 2011]
Mouse(19116) prolactin receptor
Rat(24684) prolactin receptor
chicken(395660) prolactin receptor
dog(479363) prolactin receptor
domestic cat(101101444) prolactin receptor
Horse(100053793) prolactin receptor
domestic guinea pig(100722352) prolactin receptor
Domestic Rabbit(100009046) prolactin receptor
Domestic Rabbit(100009321) prolactin receptor
cow(281422) prolactin receptor
sheep(554331) prolactin receptor
Goat(100861318) prolactin receptor
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
F7751 Fluoxymesterone solid (photosensitive) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000949 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000949 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000949 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008932 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008932 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008932 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000949 Rosetta Predictions human pricing
NM_001034111 Rosetta Predictions rat pricing
NM_012630 Rosetta Predictions rat pricing
NM_011169 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113407 predicted 596
2 SASI_Hs01_00113408 predicted 1139
3 SASI_Hs01_00113409 predicted 1490
4 SASI_Hs01_00113410 predicted 1282
5 SASI_Hs01_00113411 predicted 1661
6 SASI_Hs02_00303561 predicted 2086
7 SASI_Hs01_00113412 predicted 906
8 SASI_Hs01_00113413 predicted 864
9 SASI_Hs01_00113414 predicted 1687
10 SASI_Hs01_00113415 predicted 1593
11 SASI_Hs01_00113416 predicted 1253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117478 predicted 445
2 SASI_Rn01_00117479 predicted 476
3 SASI_Rn01_00117480 predicted 337
4 SASI_Rn01_00117481 predicted 389
5 SASI_Rn01_00117482 predicted 734
6 SASI_Rn01_00117483 predicted 390
7 SASI_Rn01_00117484 predicted 735
8 SASI_Rn01_00117485 predicted 759
9 SASI_Rn01_00117486 predicted 392
10 SASI_Rn01_00117487 predicted 807
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00122052 predicted 460
2 SASI_Rn01_00122053 predicted 489
3 SASI_Rn01_00122054 predicted 346
4 SASI_Rn01_00122055 predicted 400
5 SASI_Rn01_00122056 predicted 739
6 SASI_Rn01_00122057 predicted 402
7 SASI_Rn01_00122058 predicted 747
8 SASI_Rn01_00122059 predicted 772
9 SASI_Rn01_00122060 predicted 398
10 SASI_Rn01_00122061 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011169 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00095201 predicted 478
2 SASI_Mm01_00095202 predicted 1466
3 SASI_Mm02_00320045 predicted 579
4 SASI_Mm01_00095203 predicted 1077
5 SASI_Mm01_00095205 predicted 1025
6 SASI_Mm01_00095206 predicted 675
7 SASI_Mm01_00095207 predicted 1832
8 SASI_Mm01_00095208 predicted 769
9 SASI_Mm02_00320046 predicted 1140
10 SASI_Mm01_00095210 predicted 1954
11 SASI_Mm01_00095204 predicted 1322
12 SASI_Mm01_00095209 predicted 982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000949
PRLR MISSION shRNA Bacterial Glycerol Stock
prolactin receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000949.4-1455s21c1
Sequence:CCGGGACTTGCTGGTGGAGTATTTACTCGAGTAAATACTCCACCAGCAAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-992s1c1
Sequence:CCGGCCTAGTGACTTCACCATGAATCTCGAGATTCATGGTGAAGTCACTAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-483s1c1
Sequence:CCGGCTACCAATTATTCACTGACTTCTCGAGAAGTCAGTGAATAATTGGTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-1829s1c1
Sequence:CCGGCCCTTGGATTATGTGGAGATTCTCGAGAATCTCCACATAATCCAAGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-971s1c1
Sequence:CCGGCCAGCGACCTTCATTCAGATACTCGAGTATCTGAATGAAGGTCGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-2051s1c1
Sequence:CCGGCCACCATCACTTGAACAGAATCTCGAGATTCTGTTCAAGTGATGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000949.4-2449s21c1
Sequence:CCGGACACTACAGAGTACGTGAAATCTCGAGATTTCACGTACTCTGTAGTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000949.4-1028s21c1
Sequence:CCGGCCTGTATGAAATTCGATTAAACTCGAGTTTAATCGAATTTCATACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000949
PRLR MISSION shRNA shRNA Plasmid DNA
prolactin receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000949.4-1455s21c1
Sequence:CCGGGACTTGCTGGTGGAGTATTTACTCGAGTAAATACTCCACCAGCAAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-992s1c1
Sequence:CCGGCCTAGTGACTTCACCATGAATCTCGAGATTCATGGTGAAGTCACTAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-483s1c1
Sequence:CCGGCTACCAATTATTCACTGACTTCTCGAGAAGTCAGTGAATAATTGGTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-1829s1c1
Sequence:CCGGCCCTTGGATTATGTGGAGATTCTCGAGAATCTCCACATAATCCAAGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-971s1c1
Sequence:CCGGCCAGCGACCTTCATTCAGATACTCGAGTATCTGAATGAAGGTCGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000059110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-2051s1c1
Sequence:CCGGCCACCATCACTTGAACAGAATCTCGAGATTCTGTTCAAGTGATGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000949.4-2449s21c1
Sequence:CCGGACACTACAGAGTACGTGAAATCTCGAGATTTCACGTACTCTGTAGTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000373248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000949.4-1028s21c1
Sequence:CCGGCCTGTATGAAATTCGATTAAACTCGAGTTTAATCGAATTTCATACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000949
PRLR MISSION shRNA Lentiviral Transduction Particles
prolactin receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000949.4-1455s21c1
Sequence:CCGGGACTTGCTGGTGGAGTATTTACTCGAGTAAATACTCCACCAGCAAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-992s1c1
Sequence:CCGGCCTAGTGACTTCACCATGAATCTCGAGATTCATGGTGAAGTCACTAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-483s1c1
Sequence:CCGGCTACCAATTATTCACTGACTTCTCGAGAAGTCAGTGAATAATTGGTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-1829s1c1
Sequence:CCGGCCCTTGGATTATGTGGAGATTCTCGAGAATCTCCACATAATCCAAGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059112    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-971s1c1
Sequence:CCGGCCAGCGACCTTCATTCAGATACTCGAGTATCTGAATGAAGGTCGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000059110    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000949.2-2051s1c1
Sequence:CCGGCCACCATCACTTGAACAGAATCTCGAGATTCTGTTCAAGTGATGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373247    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000949.4-2449s21c1
Sequence:CCGGACACTACAGAGTACGTGAAATCTCGAGATTTCACGTACTCTGTAGTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000373248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000949.4-1028s21c1
Sequence:CCGGCCTGTATGAAATTCGATTAAACTCGAGTTTAATCGAATTTCATACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008932
PRLR MISSION shRNA Bacterial Glycerol Stock
prolactin receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-381s1c1
Sequence:CCGGCCACCAATTATTCATTGACATCTCGAGATGTCAATGAATAATTGGTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-480s1c1
Sequence:CCGGGCAGTACACTTCCATATGGAACTCGAGTTCCATATGGAAGTGTACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-302s1c1
Sequence:CCGGCCTGAAATCCACAAATGTCGTCTCGAGACGACATTTGTGGATTTCAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-465s1c1
Sequence:CCGGCTGTTTCTTTAGCAAGCAGTACTCGAGTACTGCTTGCTAAAGAAACAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-424s1c1
Sequence:CCGGCACCTATGAATGTCCAGACTACTCGAGTAGTCTGGACATTCATAGGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008932
PRLR MISSION shRNA shRNA Plasmid DNA
prolactin receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-381s1c1
Sequence:CCGGCCACCAATTATTCATTGACATCTCGAGATGTCAATGAATAATTGGTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-480s1c1
Sequence:CCGGGCAGTACACTTCCATATGGAACTCGAGTTCCATATGGAAGTGTACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-302s1c1
Sequence:CCGGCCTGAAATCCACAAATGTCGTCTCGAGACGACATTTGTGGATTTCAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-465s1c1
Sequence:CCGGCTGTTTCTTTAGCAAGCAGTACTCGAGTACTGCTTGCTAAAGAAACAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000065765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-424s1c1
Sequence:CCGGCACCTATGAATGTCCAGACTACTCGAGTAGTCTGGACATTCATAGGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008932
PRLR MISSION shRNA Lentiviral Transduction Particles
prolactin receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-381s1c1
Sequence:CCGGCCACCAATTATTCATTGACATCTCGAGATGTCAATGAATAATTGGTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065767    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-480s1c1
Sequence:CCGGGCAGTACACTTCCATATGGAACTCGAGTTCCATATGGAAGTGTACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-302s1c1
Sequence:CCGGCCTGAAATCCACAAATGTCGTCTCGAGACGACATTTGTGGATTTCAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-465s1c1
Sequence:CCGGCTGTTTCTTTAGCAAGCAGTACTCGAGTACTGCTTGCTAAAGAAACAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000065765    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008932.1-424s1c1
Sequence:CCGGCACCTATGAATGTCCAGACTACTCGAGTAGTCTGGACATTCATAGGTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)