EMAIL THIS PAGE TO A FRIEND

PRMT10

protein arginine methyltransferase 10 (putative)

72 Gene Product Result for
UniProtKB ID: Q6P2P2, A8KA39, Q6ZR58, Q8N383, Q9BT55, Q9NT98
Gene ID:
Mouse(102182) protein arginine methyltransferase 10 (putative)
Rat(291947) protein arginine methyltransferase 10 (putative)
naked mole-rat(101724582) protein arginine methyltransferase 10 (putative)
domestic guinea pig(100722293) protein arginine methyltransferase 10 (putative)
cow(532021) protein arginine methyltransferase 10 (putative)
sheep(101108080) protein arginine methyltransferase 10 (putative)
Thale Cress(839393) protein arginine methyltransferase 10
chicken(422470) protein arginine methyltransferase 10 (putative)
Zebrafish(553290) protein arginine methyltransferase 10 (putative)
dog(475460) protein arginine methyltransferase 10 (putative)
Horse(100070676) protein arginine methyltransferase 10 (putative)
domestic cat(101082901) protein arginine methyltransferase 10 (putative)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138364 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138364 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138364 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138364 Rosetta Predictions human pricing
XM_001071216 Rosetta Predictions rat pricing
XM_214662 Rosetta Predictions rat pricing
NM_001081240 Rosetta Predictions mouse pricing
XM_486137 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138364 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363464 predicted 1630
2 SASI_Hs01_00103824 predicted 739
3 SASI_Hs01_00103825 predicted 838
4 SASI_Hs01_00103826 predicted 1541
5 SASI_Hs01_00103827 predicted 1236
6 SASI_Hs02_00363465 predicted 986
7 SASI_Hs01_00103828 predicted 2206
8 SASI_Hs02_00363466 predicted 2501
9 SASI_Hs01_00103831 predicted 2105
10 SASI_Hs01_00103832 predicted 2431
11 SASI_Hs01_00103829 predicted 1627
12 SASI_Hs01_00103830 predicted 1974
13 SASI_Hs01_00103833 predicted 2279
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071216 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334218 predicted 360
2 SASI_Rn02_00334219 predicted 2138
3 SASI_Rn02_00334220 predicted 1538
4 SASI_Rn02_00334221 predicted 2073
5 SASI_Rn02_00334222 predicted 2257
6 SASI_Rn02_00334223 predicted 524
7 SASI_Rn02_00334224 predicted 913
8 SASI_Rn02_00334225 predicted 2267
9 SASI_Rn02_00334226 predicted 1954
10 SASI_Rn02_00334227 predicted 2447
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_214662 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00375485 predicted 356
2 SASI_Rn02_00375486 predicted 2135
3 SASI_Rn02_00375487 predicted 1547
4 SASI_Rn02_00375488 predicted 2072
5 SASI_Rn02_00375489 predicted 2259
6 SASI_Rn02_00375490 predicted 526
7 SASI_Rn02_00375491 predicted 906
8 SASI_Rn02_00375492 predicted 2267
9 SASI_Rn02_00375493 predicted 1955
10 SASI_Rn02_00375494 predicted 2444
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00296547 predicted 283
2 SASI_Mm02_00296548 predicted 1079
3 SASI_Mm02_00296549 predicted 1330
4 SASI_Mm02_00296550 predicted 1942
5 SASI_Mm02_00296551 predicted 2122
6 SASI_Mm02_00296552 predicted 2301
7 SASI_Mm02_00296553 predicted 1480
8 SASI_Mm02_00296554 predicted 2219
9 SASI_Mm02_00296555 predicted 2310
10 SASI_Mm02_00296556 predicted 755
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_486137 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00218125 predicted 291
2 SASI_Mm01_00218126 predicted 1089
3 SASI_Mm01_00218127 predicted 1329
4 SASI_Mm01_00218128 predicted 1949
5 SASI_Mm01_00218129 predicted 2431
6 SASI_Mm01_00218130 predicted 2305
7 SASI_Mm01_00218131 predicted 1493
8 SASI_Mm01_00218132 predicted 2217
9 SASI_Mm01_00218133 predicted 2317
10 SASI_Mm01_00218134 predicted 761
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138364
VALIDATED
PRMT10 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 10 (putative)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1938s21c1
Sequence:CCGGGCACACTTGGGCAGGTTAAACCTCGAGGTTTAACCTGCCCAAGTGTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_138364.2-2417s1c1
Sequence:CCGGCTAGATTTAATGACTCCGTATCTCGAGATACGGAGTCATTAAATCTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-2016s1c1
Sequence:CCGGCCAATCACTTTCCTAAAGAAACTCGAGTTTCTTTAGGAAAGTGATTGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-594s1c1
Sequence:CCGGGCTGGCACTTTATCATGCTTACTCGAGTAAGCATGATAAAGTGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1061s1c1
Sequence:CCGGGCAGTAGAATGTGCAGAGATACTCGAGTATCTCTGCACATTCTACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1652s1c1
Sequence:CCGGGCTAACCTTCAGACCAGTAAACTCGAGTTTACTGGTCTGAAGGTTAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-521s1c1
Sequence:CCGGGCAGTGAAGCTAAACCCTGATCTCGAGATCAGGGTTTAGCTTCACTGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1651s1c1
Sequence:CCGGCGCTAACCTTCAGACCAGTAACTCGAGTTACTGGTCTGAAGGTTAGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1736s21c1
Sequence:CCGGCCATATCATGAAGGCTTTAAACTCGAGTTTAAAGCCTTCATGATATGGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1087s21c1
Sequence:CCGGACATCATAGAGTGGGTATTAACTCGAGTTAATACCCACTCTATGATGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-2294s21c1
Sequence:CCGGGAACGTACTCTTGGATTAAATCTCGAGATTTAATCCAAGAGTACGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138364
VALIDATED
PRMT10 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 10 (putative)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1938s21c1
Sequence:CCGGGCACACTTGGGCAGGTTAAACCTCGAGGTTTAACCTGCCCAAGTGTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_138364.2-2417s1c1
Sequence:CCGGCTAGATTTAATGACTCCGTATCTCGAGATACGGAGTCATTAAATCTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-2016s1c1
Sequence:CCGGCCAATCACTTTCCTAAAGAAACTCGAGTTTCTTTAGGAAAGTGATTGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-594s1c1
Sequence:CCGGGCTGGCACTTTATCATGCTTACTCGAGTAAGCATGATAAAGTGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1061s1c1
Sequence:CCGGGCAGTAGAATGTGCAGAGATACTCGAGTATCTCTGCACATTCTACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1652s1c1
Sequence:CCGGGCTAACCTTCAGACCAGTAAACTCGAGTTTACTGGTCTGAAGGTTAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-521s1c1
Sequence:CCGGGCAGTGAAGCTAAACCCTGATCTCGAGATCAGGGTTTAGCTTCACTGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1651s1c1
Sequence:CCGGCGCTAACCTTCAGACCAGTAACTCGAGTTACTGGTCTGAAGGTTAGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000420608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1736s21c1
Sequence:CCGGCCATATCATGAAGGCTTTAAACTCGAGTTTAAAGCCTTCATGATATGGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000429486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1087s21c1
Sequence:CCGGACATCATAGAGTGGGTATTAACTCGAGTTAATACCCACTCTATGATGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000430123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-2294s21c1
Sequence:CCGGGAACGTACTCTTGGATTAAATCTCGAGATTTAATCCAAGAGTACGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138364
VALIDATED
PRMT10 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 10 (putative)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443475    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1938s21c1
Sequence:CCGGGCACACTTGGGCAGGTTAAACCTCGAGGTTTAACCTGCCCAAGTGTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_138364.2-2417s1c1
Sequence:CCGGCTAGATTTAATGACTCCGTATCTCGAGATACGGAGTCATTAAATCTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-2016s1c1
Sequence:CCGGCCAATCACTTTCCTAAAGAAACTCGAGTTTCTTTAGGAAAGTGATTGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-594s1c1
Sequence:CCGGGCTGGCACTTTATCATGCTTACTCGAGTAAGCATGATAAAGTGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168372    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1061s1c1
Sequence:CCGGGCAGTAGAATGTGCAGAGATACTCGAGTATCTCTGCACATTCTACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1652s1c1
Sequence:CCGGGCTAACCTTCAGACCAGTAAACTCGAGTTTACTGGTCTGAAGGTTAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-521s1c1
Sequence:CCGGGCAGTGAAGCTAAACCCTGATCTCGAGATCAGGGTTTAGCTTCACTGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138364.2-1651s1c1
Sequence:CCGGCGCTAACCTTCAGACCAGTAACTCGAGTTACTGGTCTGAAGGTTAGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000420608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1736s21c1
Sequence:CCGGCCATATCATGAAGGCTTTAAACTCGAGTTTAAAGCCTTCATGATATGGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000429486    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-1087s21c1
Sequence:CCGGACATCATAGAGTGGGTATTAACTCGAGTTAATACCCACTCTATGATGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000430123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138364.2-2294s21c1
Sequence:CCGGGAACGTACTCTTGGATTAAATCTCGAGATTTAATCCAAGAGTACGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081240
VALIDATED
PRMT10 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 10 (putative)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-380s21c1
Sequence:CCGGCTTCATGCACTGAGCCGAATACTCGAGTATTCGGCTCAGTGCATGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081240.3-2361s21c1
Sequence:CCGGTCCGGGTATGTCTGGATTTATCTCGAGATAAATCCAGACATACCCGGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-742s21c1
Sequence:CCGGAGCTGGCGCACAATCAGTATACTCGAGTATACTGATTGTGCGCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-274s21c1
Sequence:CCGGCGGCACTGCTTATGCCCATTACTCGAGTAATGGGCATAAGCAGTGCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-2431s21c1
Sequence:CCGGGGATCTGATGACTCCATATTTCTCGAGAAATATGGAGTCATCAGATCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081240
VALIDATED
PRMT10 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 10 (putative)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-380s21c1
Sequence:CCGGCTTCATGCACTGAGCCGAATACTCGAGTATTCGGCTCAGTGCATGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081240.3-2361s21c1
Sequence:CCGGTCCGGGTATGTCTGGATTTATCTCGAGATAAATCCAGACATACCCGGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-742s21c1
Sequence:CCGGAGCTGGCGCACAATCAGTATACTCGAGTATACTGATTGTGCGCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000257622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-274s21c1
Sequence:CCGGCGGCACTGCTTATGCCCATTACTCGAGTAATGGGCATAAGCAGTGCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000247054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-2431s21c1
Sequence:CCGGGGATCTGATGACTCCATATTTCTCGAGAAATATGGAGTCATCAGATCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081240
VALIDATED
PRMT10 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 10 (putative)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-380s21c1
Sequence:CCGGCTTCATGCACTGAGCCGAATACTCGAGTATTCGGCTCAGTGCATGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001081240.3-2361s21c1
Sequence:CCGGTCCGGGTATGTCTGGATTTATCTCGAGATAAATCCAGACATACCCGGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-742s21c1
Sequence:CCGGAGCTGGCGCACAATCAGTATACTCGAGTATACTGATTGTGCGCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000257622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-274s21c1
Sequence:CCGGCGGCACTGCTTATGCCCATTACTCGAGTAATGGGCATAAGCAGTGCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000247054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081240.3-2431s21c1
Sequence:CCGGGGATCTGATGACTCCATATTTCTCGAGAAATATGGAGTCATCAGATCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)