EMAIL THIS PAGE TO A FRIEND

PRMT1

protein arginine methyltransferase 1

172 Gene Product Result for
Synonyms: ANM1 HCP1 HRMT1L2 IR1B4
Gene ID:
Human(3276) Summary: This gene encodes a member of the protein arginine N-methyltransferase (PRMT) family. Post-translational modification of target proteins by PRMTs plays an important regulatory role in many biological processes, whereby PRMTs methylate arginine residues by transferring methyl groups from S-adenosyl-L-methionine to terminal guanidino nitrogen atoms. The encoded protein is a type I PRMT and is responsible for the majority of cellular arginine methylation activity. Increased expression of this gene may play a role in many types of cancer. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 5. [provided by RefSeq, Dec 2011]
Mouse(15469) protein arginine N-methyltransferase 1
Rat(60421) protein arginine methyltransferase 1
Zebrafish(321974) protein arginine methyltransferase 1
dog(476411) protein arginine methyltransferase 1
domestic cat(101095389) protein arginine methyltransferase 1
Horse(100052097) protein arginine methyltransferase 1
cow(520388) protein arginine methyltransferase 1
domestic guinea pig(100724273) protein arginine methyltransferase 1
naked mole-rat(101721462) protein arginine methyltransferase 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
P6996 Anti-PRMT1 (TK-16) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution hamster, human, rat, mouse, monkey
immunoprecipitation (IP), microarray, western blot pricing
SAB2702407 Anti-Prmt1 antibody produced in rabbit affinity isolated antibody zebrafish
western blot pricing
SAB2702419 Anti-Prmt1 antibody produced in rabbit affinity isolated antibody zebrafish
pricing
SAB2107974 Anti-PRMT1 antibody produced in rabbit IgG fraction of antiserum mouse, rabbit, bovine, rat, human, canine, guinea pig, zebrafish, pig, horse
immunohistochemistry, western blot pricing
P6871 Anti-PRMT1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, microarray, western blot pricing
HPA069769 Anti-PRMT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunohistochemistry, western blot pricing
HPA072136 Anti-PRMT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody human
immunofluorescence, western blot pricing
P1620 Anti-PRMT1 antibody, Mouse monoclonal clone PRMT1-171, purified from hybridoma cell culture monkey, rat, hamster, mouse, human, canine, chicken, bovine
ELISA, immunoprecipitation (IP), western blot pricing
SAB2702289 Monoclonal Anti-PRMT1 antibody produced in mouse clone GT779, affinity isolated antibody human, mouse
immunofluorescence, western blot pricing
SAB2702290 Monoclonal Anti-PRMT1 antibody produced in mouse clone GT10111, affinity isolated antibody mouse, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001536 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001536 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001536 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019830 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019830 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019830 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001536 Rosetta Predictions human pricing
NM_198318 Rosetta Predictions human pricing
NM_198319 Rosetta Predictions human pricing
NM_024363 Rosetta Predictions rat pricing
NM_019830 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001536 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133430 predicted 905
2 SASI_Hs01_00133431 predicted 916
3 SASI_Hs01_00133433 predicted 534
4 SASI_Hs01_00133437 predicted 700
5 SASI_Hs02_00332070 predicted 690
6 SASI_Hs01_00133429 predicted 985
7 SASI_Hs01_00133432 predicted 972
8 SASI_Hs01_00133436 predicted 393
9 SASI_Hs02_00332071 predicted 367
10 SASI_Hs01_00133435 predicted 983
11 SASI_Hs01_00133434 predicted 354
12 SASI_Hs01_00133438 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198318 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189968 predicted 849
2 SASI_Hs01_00189969 predicted 863
3 SASI_Hs01_00189971 predicted 472
4 SASI_Hs01_00189976 predicted 641
5 SASI_Hs02_00371869 predicted 633
6 SASI_Hs02_00371870 predicted 927
7 SASI_Hs01_00189970 predicted 922
8 SASI_Hs01_00189975 predicted 334
9 SASI_Hs02_00371871 predicted 322
10 SASI_Hs01_00189974 predicted 924
11 SASI_Hs01_00189972 predicted 990
12 SASI_Hs01_00189973 predicted 299
13 SASI_Hs01_00189977 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198319 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030430 predicted 1024
2 SASI_Hs01_00030431 predicted 1036
3 SASI_Hs01_00030433 predicted 646
4 SASI_Hs01_00030437 predicted 818
5 SASI_Hs02_00371872 predicted 814
6 SASI_Hs01_00030429 predicted 1103
7 SASI_Hs01_00030432 predicted 1095
8 SASI_Hs01_00030436 predicted 508
9 SASI_Hs02_00371873 predicted 488
10 SASI_Hs01_00030435 predicted 1106
11 SASI_Hs01_00030434 predicted 467
12 SASI_Hs01_00030438 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024363 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00109470 predicted 548
2 SASI_Rn02_00263945 predicted 948
3 SASI_Rn01_00109471 predicted 593
4 SASI_Rn01_00109472 predicted 719
5 SASI_Rn02_00263946 predicted 948
6 SASI_Rn02_00263947 predicted 976
7 SASI_Rn01_00109473 predicted 550
8 SASI_Rn01_00109474 predicted 871
9 SASI_Rn01_00109476 predicted 804
10 SASI_Rn01_00109477 predicted 435
11 SASI_Rn01_00109475 predicted 319
12 SASI_Rn01_00109478 predicted 918
13 SASI_Rn01_00109479 predicted 330
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019830 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00110618 predicted 618
2 SASI_Mm02_00325127 predicted 608
3 SASI_Mm02_00325128 predicted 252
4 SASI_Mm02_00325129 predicted 894
5 SASI_Mm02_00325130 predicted 735
6 SASI_Mm01_00110622 predicted 617
7 SASI_Mm01_00110624 predicted 752
8 SASI_Mm01_00110625 predicted 657
9 SASI_Mm01_00110626 predicted 233
10 SASI_Mm01_00110627 predicted 499
11 SASI_Mm01_00110619 predicted 350
12 SASI_Mm01_00110620 predicted 793
13 SASI_Mm01_00110621 predicted 671
14 SASI_Mm01_00110623 predicted 688
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001536
VALIDATED
PRMT1 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 1
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000035929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-613s1c1
Sequence:CCGGCCGGCAGTACAAAGACTACAACTCGAGTTGTAGTCTTTGTACTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-100s1c1
Sequence:CCGGCCAGGCGGAAAGCAGTGAGAACTCGAGTTCTCACTGCTTTCCGCCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-817s1c1
Sequence:CCGGGCAAGTGAAGCGGAATGACTACTCGAGTAGTCATTCCGCTTCACTTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-352s1c1
Sequence:CCGGGTGTTCCAGTATCTCTGATTACTCGAGTAATCAGAGATACTGGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001536.2-748s1c1
Sequence:CCGGCCTCATAAAGGAGGTGGACATCTCGAGATGTCCACCTCCTTTATGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-177s21c1
Sequence:GTACCGGGGACATGACATCCAAAGATTACTCGAGTAATCTTTGGATGTCATGTCCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-266s21c1
Sequence:CCGGCTTACCGCAACTCCATGTTTCCTCGAGGAAACATGGAGTTGCGGTAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-396s21c1
Sequence:CCGGGTGTTCCAGTATCTCTGATTACTCGAGTAATCAGAGATACTGGAACACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-657s21c1
Sequence:CCGGCCGGCAGTACAAAGACTACAACTCGAGTTGTAGTCTTTGTACTGCCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-203s21c1
Sequence:CCGGTTGACTCCTACGCACACTTTGCTCGAGCAAAGTGTGCGTAGGAGTCAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-560s21c1
Sequence:GTACCGGTGCTCAACACCGTGCTCTATGCTCGAGCATAGAGCACGGTGTTGAGCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-1194s21c1
Sequence:CCGGTGAGCGTTCCTAGGCGGTTTCCTCGAGGAAACCGCCTAGGAACGCTCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-781s21c1
Sequence:GTACCGGACCAACGCCTGCCTCATAAAGCTCGAGCTTTATGAGGCAGGCGTTGGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001536
VALIDATED
PRMT1 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 1
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000035929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-613s1c1
Sequence:CCGGCCGGCAGTACAAAGACTACAACTCGAGTTGTAGTCTTTGTACTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-100s1c1
Sequence:CCGGCCAGGCGGAAAGCAGTGAGAACTCGAGTTCTCACTGCTTTCCGCCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-817s1c1
Sequence:CCGGGCAAGTGAAGCGGAATGACTACTCGAGTAGTCATTCCGCTTCACTTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-352s1c1
Sequence:CCGGGTGTTCCAGTATCTCTGATTACTCGAGTAATCAGAGATACTGGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001536.2-748s1c1
Sequence:CCGGCCTCATAAAGGAGGTGGACATCTCGAGATGTCCACCTCCTTTATGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000382079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-177s21c1
Sequence:GTACCGGGGACATGACATCCAAAGATTACTCGAGTAATCTTTGGATGTCATGTCCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-266s21c1
Sequence:CCGGCTTACCGCAACTCCATGTTTCCTCGAGGAAACATGGAGTTGCGGTAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-396s21c1
Sequence:CCGGGTGTTCCAGTATCTCTGATTACTCGAGTAATCAGAGATACTGGAACACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000290478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-657s21c1
Sequence:CCGGCCGGCAGTACAAAGACTACAACTCGAGTTGTAGTCTTTGTACTGCCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-203s21c1
Sequence:CCGGTTGACTCCTACGCACACTTTGCTCGAGCAAAGTGTGCGTAGGAGTCAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-560s21c1
Sequence:GTACCGGTGCTCAACACCGTGCTCTATGCTCGAGCATAGAGCACGGTGTTGAGCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000310243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-1194s21c1
Sequence:CCGGTGAGCGTTCCTAGGCGGTTTCCTCGAGGAAACCGCCTAGGAACGCTCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000380133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-781s21c1
Sequence:GTACCGGACCAACGCCTGCCTCATAAAGCTCGAGCTTTATGAGGCAGGCGTTGGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001536
VALIDATED
PRMT1 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 1
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000035929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-613s1c1
Sequence:CCGGCCGGCAGTACAAAGACTACAACTCGAGTTGTAGTCTTTGTACTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-100s1c1
Sequence:CCGGCCAGGCGGAAAGCAGTGAGAACTCGAGTTCTCACTGCTTTCCGCCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-817s1c1
Sequence:CCGGGCAAGTGAAGCGGAATGACTACTCGAGTAGTCATTCCGCTTCACTTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_001536.2-352s1c1
Sequence:CCGGGTGTTCCAGTATCTCTGATTACTCGAGTAATCAGAGATACTGGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001536.2-748s1c1
Sequence:CCGGCCTCATAAAGGAGGTGGACATCTCGAGATGTCCACCTCCTTTATGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000382079    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-177s21c1
Sequence:GTACCGGGGACATGACATCCAAAGATTACTCGAGTAATCTTTGGATGTCATGTCCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-266s21c1
Sequence:CCGGCTTACCGCAACTCCATGTTTCCTCGAGGAAACATGGAGTTGCGGTAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290479    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-396s21c1
Sequence:CCGGGTGTTCCAGTATCTCTGATTACTCGAGTAATCAGAGATACTGGAACACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000290478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-657s21c1
Sequence:CCGGCCGGCAGTACAAAGACTACAACTCGAGTTGTAGTCTTTGTACTGCCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296581    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-203s21c1
Sequence:CCGGTTGACTCCTACGCACACTTTGCTCGAGCAAAGTGTGCGTAGGAGTCAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380476    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-560s21c1
Sequence:GTACCGGTGCTCAACACCGTGCTCTATGCTCGAGCATAGAGCACGGTGTTGAGCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000310243    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_001536.3-1194s21c1
Sequence:CCGGTGAGCGTTCCTAGGCGGTTTCCTCGAGGAAACCGCCTAGGAACGCTCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000380133    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001536.3-781s21c1
Sequence:GTACCGGACCAACGCCTGCCTCATAAAGCTCGAGCTTTATGAGGCAGGCGTTGGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019830
VALIDATED
PRMT1 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019830.1-833s1c1
Sequence:CCGGGCAAGTGAAGAGGAACGACTACTCGAGTAGTCGTTCCTCTTCACTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019830.1-243s1c1
Sequence:CCGGCGCAACTCCATGTTTCACAATCTCGAGATTGTGAAACATGGAGTTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019830.1-144s1c1
Sequence:CCGGGCTGAGGACATGACATCCAAACTCGAGTTTGGATGTCATGTCCTCAGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019830.1-629s1c1
Sequence:CCGGCCGACAATATAAAGACTACAACTCGAGTTGTAGTCTTTATATTGTCGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-991s21c1
Sequence:CCGGAGACTGGCGAGGAGATCTTTGCTCGAGCAAAGATCTCCTCGCCAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-678s21c1
Sequence:CCGGTTTGATATGTCCTGCATTAAACTCGAGTTTAATGCAGGACATATCAAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-144s21c1
Sequence:CCGGGCTGAGGACATGACATCCAAACTCGAGTTTGGATGTCATGTCCTCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-369s21c1
Sequence:CCGGTGTTCCAGTATCTCCGATTATCTCGAGATAATCGGAGATACTGGAACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-243s21c1
Sequence:CCGGCGCAACTCCATGTTTCACAATCTCGAGATTGTGAAACATGGAGTTGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019830
VALIDATED
PRMT1 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019830.1-833s1c1
Sequence:CCGGGCAAGTGAAGAGGAACGACTACTCGAGTAGTCGTTCCTCTTCACTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019830.1-243s1c1
Sequence:CCGGCGCAACTCCATGTTTCACAATCTCGAGATTGTGAAACATGGAGTTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019830.1-144s1c1
Sequence:CCGGGCTGAGGACATGACATCCAAACTCGAGTTTGGATGTCATGTCCTCAGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000018490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019830.1-629s1c1
Sequence:CCGGCCGACAATATAAAGACTACAACTCGAGTTGTAGTCTTTATATTGTCGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-991s21c1
Sequence:CCGGAGACTGGCGAGGAGATCTTTGCTCGAGCAAAGATCTCCTCGCCAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-678s21c1
Sequence:CCGGTTTGATATGTCCTGCATTAAACTCGAGTTTAATGCAGGACATATCAAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-144s21c1
Sequence:CCGGGCTGAGGACATGACATCCAAACTCGAGTTTGGATGTCATGTCCTCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000274580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-369s21c1
Sequence:CCGGTGTTCCAGTATCTCCGATTATCTCGAGATAATCGGAGATACTGGAACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000319739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-243s21c1
Sequence:CCGGCGCAACTCCATGTTTCACAATCTCGAGATTGTGAAACATGGAGTTGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019830
VALIDATED
PRMT1 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019830.1-833s1c1
Sequence:CCGGGCAAGTGAAGAGGAACGACTACTCGAGTAGTCGTTCCTCTTCACTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018492    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019830.1-243s1c1
Sequence:CCGGCGCAACTCCATGTTTCACAATCTCGAGATTGTGAAACATGGAGTTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018491    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019830.1-144s1c1
Sequence:CCGGGCTGAGGACATGACATCCAAACTCGAGTTTGGATGTCATGTCCTCAGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000018490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019830.1-629s1c1
Sequence:CCGGCCGACAATATAAAGACTACAACTCGAGTTGTAGTCTTTATATTGTCGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274536    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-991s21c1
Sequence:CCGGAGACTGGCGAGGAGATCTTTGCTCGAGCAAAGATCTCCTCGCCAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-678s21c1
Sequence:CCGGTTTGATATGTCCTGCATTAAACTCGAGTTTAATGCAGGACATATCAAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-144s21c1
Sequence:CCGGGCTGAGGACATGACATCCAAACTCGAGTTTGGATGTCATGTCCTCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000274580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-369s21c1
Sequence:CCGGTGTTCCAGTATCTCCGATTATCTCGAGATAATCGGAGATACTGGAACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000319739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019830.2-243s21c1
Sequence:CCGGCGCAACTCCATGTTTCACAATCTCGAGATTGTGAAACATGGAGTTGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)