EMAIL THIS PAGE TO A FRIEND

PRMT2

protein arginine methyltransferase 2

92 Gene Product Result for
Synonyms: HRMT1L1
Gene ID:
Mouse(15468) protein arginine N-methyltransferase 2
Rat(499420) protein arginine methyltransferase 2
Zebrafish(558841) protein arginine methyltransferase 2
dog(480811) protein arginine methyltransferase 2
Horse(100054798) protein arginine methyltransferase 2
domestic cat(101099068) protein arginine methyltransferase 2
cow(507839) protein arginine methyltransferase 2
sheep(101113453) protein arginine methyltransferase 2
domestic guinea pig(100730972) protein arginine methyltransferase 2
naked mole-rat(101720376) protein arginine methyltransferase 2
Domestic Rabbit(100356731) protein arginine methyltransferase 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001535 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001535 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001535 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001535 Rosetta Predictions human pricing
NM_206962 Rosetta Predictions human pricing
NM_001025144 Rosetta Predictions rat pricing
NM_001077638 Rosetta Predictions mouse pricing
NM_133182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001535 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190716 predicted 1127
2 SASI_Hs01_00190718 predicted 1095
3 SASI_Hs01_00190719 predicted 556
4 SASI_Hs01_00190720 predicted 1591
5 SASI_Hs01_00190721 predicted 520
6 SASI_Hs01_00190722 predicted 1111
7 SASI_Hs01_00190723 predicted 1220
8 SASI_Hs01_00190724 predicted 758
9 SASI_Hs01_00190725 predicted 1491
10 SASI_Hs02_00332069 predicted 962
11 SASI_Hs01_00190717 predicted 1504
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014333 predicted 1233
2 SASI_Hs01_00014335 predicted 1207
3 SASI_Hs01_00014336 predicted 672
4 SASI_Hs01_00014337 predicted 1708
5 SASI_Hs01_00014338 predicted 629
6 SASI_Hs01_00014339 predicted 1217
7 SASI_Hs01_00014340 predicted 1336
8 SASI_Hs01_00014341 predicted 868
9 SASI_Hs01_00014342 predicted 1608
10 SASI_Hs02_00373662 predicted 1064
11 SASI_Hs01_00014334 predicted 1611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025144 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00061523 predicted 513
2 SASI_Rn01_00061524 predicted 1409
3 SASI_Rn01_00061525 predicted 446
4 SASI_Rn01_00061526 predicted 959
5 SASI_Rn01_00061527 predicted 454
6 SASI_Rn01_00061528 predicted 1346
7 SASI_Rn01_00061529 predicted 1250
8 SASI_Rn01_00061531 predicted 1049
9 SASI_Rn01_00061532 predicted 782
10 SASI_Rn02_00203070 predicted 248
11 SASI_Rn01_00061530 predicted 539
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001077638 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00292832 predicted 768
2 SASI_Mm02_00292833 predicted 429
3 SASI_Mm02_00292834 predicted 1478
4 SASI_Mm02_00292835 predicted 532
5 SASI_Mm02_00292836 predicted 517
6 SASI_Mm02_00292837 predicted 1032
7 SASI_Mm02_00292838 predicted 1323
8 SASI_Mm02_00292839 predicted 882
9 SASI_Mm02_00292840 predicted 748
10 SASI_Mm02_00292841 predicted 880
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176730 predicted 768
2 SASI_Mm01_00176731 predicted 426
3 SASI_Mm02_00338342 predicted 1479
4 SASI_Mm01_00176732 predicted 527
5 SASI_Mm01_00176733 predicted 510
6 SASI_Mm01_00176734 predicted 1023
7 SASI_Mm01_00176735 predicted 1319
8 SASI_Mm01_00176737 predicted 884
9 SASI_Mm01_00176738 predicted 744
10 SASI_Mm01_00176739 predicted 877
11 SASI_Mm01_00176736 predicted 1280
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133182
VALIDATED
PRMT2 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000309582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133182.2-1682s21c1
Sequence:CCGGGCTGTGTATATAGGTGTTCATCTCGAGATGAACACCTATATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-506s21c1
Sequence:CCGGGAGGAGTACTTCGACAGCTATCTCGAGATAGCTGTCGAAGTACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-1594s1c1
Sequence:CCGGGCTGTGTATATAGGTGTTCATCTCGAGATGAACACCTATATACACAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-1288s1c1
Sequence:CCGGCGGGTTCTGTTGTGTTACAAACTCGAGTTTGTAACACAACAGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-979s1c1
Sequence:CCGGGCCAAAGTCGAATCATATCTTCTCGAGAAGATATGATTCGACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-416s1c1
Sequence:CCGGGAGGAGTACTTCGACAGCTATCTCGAGATAGCTGTCGAAGTACTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133182.1-233s1c1
Sequence:CCGGGCAGACTATACGGCCACCGATCTCGAGATCGGTGGCCGTATAGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-1069s21c1
Sequence:CCGGGCCAAAGTCGAATCATATCTTCTCGAGAAGATATGATTCGACTTTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-1377s21c1
Sequence:CCGGCGGGTTCTGTTGTGTTACAAACTCGAGTTTGTAACACAACAGAACCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133182
VALIDATED
PRMT2 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000309582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133182.2-1682s21c1
Sequence:CCGGGCTGTGTATATAGGTGTTCATCTCGAGATGAACACCTATATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000331970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-506s21c1
Sequence:CCGGGAGGAGTACTTCGACAGCTATCTCGAGATAGCTGTCGAAGTACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-1594s1c1
Sequence:CCGGGCTGTGTATATAGGTGTTCATCTCGAGATGAACACCTATATACACAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-1288s1c1
Sequence:CCGGCGGGTTCTGTTGTGTTACAAACTCGAGTTTGTAACACAACAGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-979s1c1
Sequence:CCGGGCCAAAGTCGAATCATATCTTCTCGAGAAGATATGATTCGACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-416s1c1
Sequence:CCGGGAGGAGTACTTCGACAGCTATCTCGAGATAGCTGTCGAAGTACTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133182.1-233s1c1
Sequence:CCGGGCAGACTATACGGCCACCGATCTCGAGATCGGTGGCCGTATAGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-1069s21c1
Sequence:CCGGGCCAAAGTCGAATCATATCTTCTCGAGAAGATATGATTCGACTTTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000309646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-1377s21c1
Sequence:CCGGCGGGTTCTGTTGTGTTACAAACTCGAGTTTGTAACACAACAGAACCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133182
VALIDATED
PRMT2 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000309582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133182.2-1682s21c1
Sequence:CCGGGCTGTGTATATAGGTGTTCATCTCGAGATGAACACCTATATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000331970    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-506s21c1
Sequence:CCGGGAGGAGTACTTCGACAGCTATCTCGAGATAGCTGTCGAAGTACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097354    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-1594s1c1
Sequence:CCGGGCTGTGTATATAGGTGTTCATCTCGAGATGAACACCTATATACACAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-1288s1c1
Sequence:CCGGCGGGTTCTGTTGTGTTACAAACTCGAGTTTGTAACACAACAGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097356    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-979s1c1
Sequence:CCGGGCCAAAGTCGAATCATATCTTCTCGAGAAGATATGATTCGACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133182.1-416s1c1
Sequence:CCGGGAGGAGTACTTCGACAGCTATCTCGAGATAGCTGTCGAAGTACTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133182.1-233s1c1
Sequence:CCGGGCAGACTATACGGCCACCGATCTCGAGATCGGTGGCCGTATAGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-1069s21c1
Sequence:CCGGGCCAAAGTCGAATCATATCTTCTCGAGAAGATATGATTCGACTTTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000309646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133182.2-1377s21c1
Sequence:CCGGCGGGTTCTGTTGTGTTACAAACTCGAGTTTGTAACACAACAGAACCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001535
VALIDATED
PRMT2 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-960s21c1
Sequence:CCGGGCAGTGCTGATAAGGATTATCCTCGAGGATAATCCTTATCAGCACTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-1132s21c1
Sequence:CCGGGGACATGAGAACCGTGCAAATCTCGAGATTTGCACGGTTCTCATGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001535.2-559s1c1
Sequence:CCGGCCAGCCACGAACAACTAAATACTCGAGTATTTAGTTGTTCGTGGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001535.2-1116s1c1
Sequence:CCGGGCACTATATTGCAGTTGGACACTCGAGTGTCCAACTGCAATATAGTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001535.2-751s1c1
Sequence:CCGGGAACGGCTTTGCTGACATCATCTCGAGATGATGTCAGCAAAGCCGTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001535.2-646s1c1
Sequence:CCGGGACTGGGATCATCAGTCTCTTCTCGAGAAGAGACTGATGATCCCAGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001535.2-503s1c1
Sequence:CCGGGAAGAGTACTTCGGCAGCTATCTCGAGATAGCTGCCGAAGTACTCTTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-1105s21c1
Sequence:CCGGCTCTGAACCGTGCACTATATTCTCGAGAATATAGTGCACGGTTCAGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001535.2-1835s21c1
Sequence:CCGGACTCCTAGGACGCACGCATATCTCGAGATATGCGTGCGTCCTAGGAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001535
VALIDATED
PRMT2 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-960s21c1
Sequence:CCGGGCAGTGCTGATAAGGATTATCCTCGAGGATAATCCTTATCAGCACTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-1132s21c1
Sequence:CCGGGGACATGAGAACCGTGCAAATCTCGAGATTTGCACGGTTCTCATGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001535.2-559s1c1
Sequence:CCGGCCAGCCACGAACAACTAAATACTCGAGTATTTAGTTGTTCGTGGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001535.2-1116s1c1
Sequence:CCGGGCACTATATTGCAGTTGGACACTCGAGTGTCCAACTGCAATATAGTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001535.2-751s1c1
Sequence:CCGGGAACGGCTTTGCTGACATCATCTCGAGATGATGTCAGCAAAGCCGTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001535.2-646s1c1
Sequence:CCGGGACTGGGATCATCAGTCTCTTCTCGAGAAGAGACTGATGATCCCAGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001535.2-503s1c1
Sequence:CCGGGAAGAGTACTTCGGCAGCTATCTCGAGATAGCTGCCGAAGTACTCTTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000363349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-1105s21c1
Sequence:CCGGCTCTGAACCGTGCACTATATTCTCGAGAATATAGTGCACGGTTCAGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001535.2-1835s21c1
Sequence:CCGGACTCCTAGGACGCACGCATATCTCGAGATATGCGTGCGTCCTAGGAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001535
VALIDATED
PRMT2 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-960s21c1
Sequence:CCGGGCAGTGCTGATAAGGATTATCCTCGAGGATAATCCTTATCAGCACTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-1132s21c1
Sequence:CCGGGGACATGAGAACCGTGCAAATCTCGAGATTTGCACGGTTCTCATGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035894    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001535.2-559s1c1
Sequence:CCGGCCAGCCACGAACAACTAAATACTCGAGTATTTAGTTGTTCGTGGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001535.2-1116s1c1
Sequence:CCGGGCACTATATTGCAGTTGGACACTCGAGTGTCCAACTGCAATATAGTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_001535.2-751s1c1
Sequence:CCGGGAACGGCTTTGCTGACATCATCTCGAGATGATGTCAGCAAAGCCGTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035895    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001535.2-646s1c1
Sequence:CCGGGACTGGGATCATCAGTCTCTTCTCGAGAAGAGACTGATGATCCCAGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035897    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_001535.2-503s1c1
Sequence:CCGGGAAGAGTACTTCGGCAGCTATCTCGAGATAGCTGCCGAAGTACTCTTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000363349    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001535.2-1105s21c1
Sequence:CCGGCTCTGAACCGTGCACTATATTCTCGAGAATATAGTGCACGGTTCAGAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358998    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001535.2-1835s21c1
Sequence:CCGGACTCCTAGGACGCACGCATATCTCGAGATATGCGTGCGTCCTAGGAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)