EMAIL THIS PAGE TO A FRIEND

PRMT7

protein arginine methyltransferase 7

56 Gene Product Result for
UniProtKB ID: Q9NVM4, B3KPR0, B3KUG9, B4E379, Q96PV5, Q9H9L0
Gene ID:
Human(54496) Summary: Arginine methylation is an apparently irreversible protein modification catalyzed by arginine methyltransferases, such as PMT7, using S-adenosylmethionine (AdoMet) as the methyl donor. Arginine methylation is implicated in signal transduction, RNA transport, and RNA splicing (Miranda et al., 2004 [PubMed 15044439]
Mouse(214572) protein arginine N-methyltransferase 7
Rat(361402) protein arginine methyltransferase 7
cow(514202) protein arginine methyltransferase 7
sheep(101119070) protein arginine methyltransferase 7
domestic guinea pig(100726568) protein arginine methyltransferase 7
naked mole-rat(101723197) protein arginine methyltransferase 7
Thale Cress(827358) protein arginine N-methyltransferase 7
Zebrafish(393475) protein arginine N-methyltransferase 7
domestic cat(101093979) protein arginine methyltransferase 7
dog(479677) protein arginine methyltransferase 7
chicken(415620) protein arginine methyltransferase 7
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019023 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019023 Rosetta Predictions human pricing
NM_001014153 Rosetta Predictions rat pricing
NM_145404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024154 predicted 1015
2 SASI_Hs01_00024155 predicted 1634
3 SASI_Hs02_00352563 predicted 600
4 SASI_Hs02_00352564 predicted 610
5 SASI_Hs02_00352565 predicted 652
6 SASI_Hs02_00352566 predicted 1902
7 SASI_Hs01_00024160 predicted 459
8 SASI_Hs02_00352567 predicted 1550
9 SASI_Hs02_00352568 predicted 1011
10 SASI_Hs02_00352569 predicted 850
11 SASI_Hs01_00024156 predicted 969
12 SASI_Hs01_00024157 predicted 1558
13 SASI_Hs01_00024158 predicted 1070
14 SASI_Hs01_00024159 predicted 1064
15 SASI_Hs01_00024161 predicted 1893
16 SASI_Hs01_00024162 predicted 1552
17 SASI_Hs01_00024163 predicted 1008
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014153 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049164 predicted 256
2 SASI_Rn01_00049165 predicted 1790
3 SASI_Rn01_00049166 predicted 589
4 SASI_Rn01_00049167 predicted 793
5 SASI_Rn01_00049168 predicted 1493
6 SASI_Rn01_00049169 predicted 899
7 SASI_Rn01_00049170 predicted 656
8 SASI_Rn01_00049171 predicted 257
9 SASI_Rn01_00049172 predicted 442
10 SASI_Rn01_00049173 predicted 342
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193500 predicted 1852
2 SASI_Mm01_00193501 predicted 1070
3 SASI_Mm01_00193502 predicted 1451
4 SASI_Mm01_00193504 predicted 1401
5 SASI_Mm02_00340737 predicted 1028
6 SASI_Mm01_00193505 predicted 448
7 SASI_Mm01_00193506 predicted 953
8 SASI_Mm02_00340738 predicted 1396
9 SASI_Mm01_00193507 predicted 618
10 SASI_Mm01_00193508 predicted 762
11 SASI_Mm01_00193503 predicted 852
12 SASI_Mm01_00193509 predicted 483
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145404
VALIDATED
PRMT7 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1430s1c1
Sequence:CCGGGCTTCCTATAGACTGATGAAACTCGAGTTTCATCAGTCTATAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1404s1c1
Sequence:CCGGAGGTGTTTACAGTTGAGAGTTCTCGAGAACTCTCAACTGTAAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1858s1c1
Sequence:CCGGGCCTCAAGAGATCCTGACTTTCTCGAGAAAGTCAGGATCTCTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1258s1c1
Sequence:CCGGGCCTCGGTTTGGAGAAATCAACTCGAGTTGATTTCTCCAAACCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1258s21c1
Sequence:CCGGGCCTCGGTTTGGAGAAATCAACTCGAGTTGATTTCTCCAAACCGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-236s1c1
Sequence:CCGGGCCGACATGCTACATGACAAACTCGAGTTTGTCATGTAGCATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1858s21c1
Sequence:CCGGGCCTCAAGAGATCCTGACTTTCTCGAGAAAGTCAGGATCTCTTGAGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1404s21c1
Sequence:CCGGAGGTGTTTACAGTTGAGAGTTCTCGAGAACTCTCAACTGTAAACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1430s21c1
Sequence:CCGGGCTTCCTATAGACTGATGAAACTCGAGTTTCATCAGTCTATAGGAAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000332232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-236s21c1
Sequence:CCGGGCCGACATGCTACATGACAAACTCGAGTTTGTCATGTAGCATGTCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145404
VALIDATED
PRMT7 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1430s1c1
Sequence:CCGGGCTTCCTATAGACTGATGAAACTCGAGTTTCATCAGTCTATAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1404s1c1
Sequence:CCGGAGGTGTTTACAGTTGAGAGTTCTCGAGAACTCTCAACTGTAAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1858s1c1
Sequence:CCGGGCCTCAAGAGATCCTGACTTTCTCGAGAAAGTCAGGATCTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1258s1c1
Sequence:CCGGGCCTCGGTTTGGAGAAATCAACTCGAGTTGATTTCTCCAAACCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1258s21c1
Sequence:CCGGGCCTCGGTTTGGAGAAATCAACTCGAGTTGATTTCTCCAAACCGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-236s1c1
Sequence:CCGGGCCGACATGCTACATGACAAACTCGAGTTTGTCATGTAGCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1858s21c1
Sequence:CCGGGCCTCAAGAGATCCTGACTTTCTCGAGAAAGTCAGGATCTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1404s21c1
Sequence:CCGGAGGTGTTTACAGTTGAGAGTTCTCGAGAACTCTCAACTGTAAACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1430s21c1
Sequence:CCGGGCTTCCTATAGACTGATGAAACTCGAGTTTCATCAGTCTATAGGAAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-236s21c1
Sequence:CCGGGCCGACATGCTACATGACAAACTCGAGTTTGTCATGTAGCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145404
VALIDATED
PRMT7 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097478    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1430s1c1
Sequence:CCGGGCTTCCTATAGACTGATGAAACTCGAGTTTCATCAGTCTATAGGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1404s1c1
Sequence:CCGGAGGTGTTTACAGTTGAGAGTTCTCGAGAACTCTCAACTGTAAACACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097476    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1858s1c1
Sequence:CCGGGCCTCAAGAGATCCTGACTTTCTCGAGAAAGTCAGGATCTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-1258s1c1
Sequence:CCGGGCCTCGGTTTGGAGAAATCAACTCGAGTTGATTTCTCCAAACCGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1258s21c1
Sequence:CCGGGCCTCGGTTTGGAGAAATCAACTCGAGTTGATTTCTCCAAACCGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097475    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145404.1-236s1c1
Sequence:CCGGGCCGACATGCTACATGACAAACTCGAGTTTGTCATGTAGCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1858s21c1
Sequence:CCGGGCCTCAAGAGATCCTGACTTTCTCGAGAAAGTCAGGATCTCTTGAGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1404s21c1
Sequence:CCGGAGGTGTTTACAGTTGAGAGTTCTCGAGAACTCTCAACTGTAAACACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-1430s21c1
Sequence:CCGGGCTTCCTATAGACTGATGAAACTCGAGTTTCATCAGTCTATAGGAAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000332232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145404.1-236s21c1
Sequence:CCGGGCCGACATGCTACATGACAAACTCGAGTTTGTCATGTAGCATGTCGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019023
VALIDATED
PRMT7 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 7
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000359087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-848s21c1
Sequence:CCGGGGTCGTGGAACAAGCTATTTCCTCGAGGAAATAGCTTGTTCCACGACCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1011s1c1
Sequence:CCGGGCCCATGTTCAGCATAGACTTCTCGAGAAGTCTATGCTGAACATGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-394s1c1
Sequence:CCGGCATGACAAAGACAGAAATGTACTCGAGTACATTTCTGTCTTTGTCATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1293s1c1
Sequence:CCGGCGATGACTACTGCGTATGGTACTCGAGTACCATACGCAGTAGTCATCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1903s1c1
Sequence:CCGGCACATCATGGACGACATGATTCTCGAGAATCATGTCGTCCATGATGTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000035150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1609s1c1
Sequence:CCGGGCTAACCACTTGGAAGATAAACTCGAGTTTATCTTCCAAGTGGTTAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-971s21c1
Sequence:CCGGAGGTGTCACCAGCCGACTTTACTCGAGTAAAGTCGGCTGGTGACACCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-605s21c1
Sequence:CCGGATGGCTTTAGTGATAAGATTACTCGAGTAATCTTATCACTAAAGCCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000359002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-1113s21c1
Sequence:CCGGCTCGTGGTGGGACATTGAAATCTCGAGATTTCAATGTCCCACCACGAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019023
VALIDATED
PRMT7 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 7
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000359087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-848s21c1
Sequence:CCGGGGTCGTGGAACAAGCTATTTCCTCGAGGAAATAGCTTGTTCCACGACCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1011s1c1
Sequence:CCGGGCCCATGTTCAGCATAGACTTCTCGAGAAGTCTATGCTGAACATGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-394s1c1
Sequence:CCGGCATGACAAAGACAGAAATGTACTCGAGTACATTTCTGTCTTTGTCATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1293s1c1
Sequence:CCGGCGATGACTACTGCGTATGGTACTCGAGTACCATACGCAGTAGTCATCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1903s1c1
Sequence:CCGGCACATCATGGACGACATGATTCTCGAGAATCATGTCGTCCATGATGTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1609s1c1
Sequence:CCGGGCTAACCACTTGGAAGATAAACTCGAGTTTATCTTCCAAGTGGTTAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-971s21c1
Sequence:CCGGAGGTGTCACCAGCCGACTTTACTCGAGTAAAGTCGGCTGGTGACACCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-605s21c1
Sequence:CCGGATGGCTTTAGTGATAAGATTACTCGAGTAATCTTATCACTAAAGCCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-1113s21c1
Sequence:CCGGCTCGTGGTGGGACATTGAAATCTCGAGATTTCAATGTCCCACCACGAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019023
VALIDATED
PRMT7 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 7
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000359087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-848s21c1
Sequence:CCGGGGTCGTGGAACAAGCTATTTCCTCGAGGAAATAGCTTGTTCCACGACCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035149    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1011s1c1
Sequence:CCGGGCCCATGTTCAGCATAGACTTCTCGAGAAGTCTATGCTGAACATGGGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-394s1c1
Sequence:CCGGCATGACAAAGACAGAAATGTACTCGAGTACATTTCTGTCTTTGTCATGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1293s1c1
Sequence:CCGGCGATGACTACTGCGTATGGTACTCGAGTACCATACGCAGTAGTCATCGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035153    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1903s1c1
Sequence:CCGGCACATCATGGACGACATGATTCTCGAGAATCATGTCGTCCATGATGTGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000035150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A3
TRC Version: 1 Clone ID:NM_019023.1-1609s1c1
Sequence:CCGGGCTAACCACTTGGAAGATAAACTCGAGTTTATCTTCCAAGTGGTTAGCTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359084    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-971s21c1
Sequence:CCGGAGGTGTCACCAGCCGACTTTACTCGAGTAAAGTCGGCTGGTGACACCTTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-605s21c1
Sequence:CCGGATGGCTTTAGTGATAAGATTACTCGAGTAATCTTATCACTAAAGCCATTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000359002    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019023.1-1113s21c1
Sequence:CCGGCTCGTGGTGGGACATTGAAATCTCGAGATTTCAATGTCCCACCACGAGTTTTTG
Availability: Usually ships in 4 to 5 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)