EMAIL THIS PAGE TO A FRIEND

PRMT8

protein arginine methyltransferase 8

162 Gene Product Result for
Synonyms: HRMT1L3 HRMT1L4
UniProtKB ID: Q9NR22, B2RDP0, Q8TBJ8
Gene ID:
Human(56341) Summary: Arginine methylation is a widespread posttranslational modification mediated by arginine methyltransferases, such as PRMT8. Arginine methylation is involved in a number of cellular processes, including DNA repair, RNA transcription, signal transduction, protein compartmentalization, and possibly protein translation (Lee et al., 2005 [PubMed 16051612]
Mouse(381813) protein arginine N-methyltransferase 8
Rat(688502) protein arginine methyltransferase 8
chicken(425989) protein arginine methyltransferase 8
domestic cat(101099564) protein arginine methyltransferase 8
Horse(100051075) protein arginine methyltransferase 8
dog(486740) protein arginine methyltransferase 8
naked mole-rat(101718680) protein arginine methyltransferase 8
domestic guinea pig(100716419) protein arginine methyltransferase 8
cow(615834) protein arginine methyltransferase 8
sheep(101117747) protein arginine methyltransferase 8
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019854 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019854 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019854 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_201371 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_201371 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_201371 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019854 Rosetta Predictions human pricing
XM_001071371 Rosetta Predictions rat pricing
XM_001071411 Rosetta Predictions rat pricing
XM_001071456 Rosetta Predictions rat pricing
XM_001071499 Rosetta Predictions rat pricing
XM_001071551 Rosetta Predictions rat pricing
XM_001071591 Rosetta Predictions rat pricing
XM_001071630 Rosetta Predictions rat pricing
NM_201371 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019854 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160273 predicted 1023
2 SASI_Hs01_00160274 predicted 1171
3 SASI_Hs01_00160275 predicted 778
4 SASI_Hs01_00160276 predicted 804
5 SASI_Hs01_00160277 predicted 980
6 SASI_Hs01_00160278 predicted 978
7 SASI_Hs01_00160279 predicted 1440
8 SASI_Hs01_00160280 predicted 795
9 SASI_Hs01_00160281 predicted 1016
10 SASI_Hs01_00160282 predicted 1246
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071371 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00334865 predicted 1775
2 SASI_Rn02_00334866 predicted 1737
3 SASI_Rn02_00334867 predicted 1765
4 SASI_Rn02_00334868 predicted 1227
5 SASI_Rn02_00334869 predicted 1076
6 SASI_Rn02_00334870 predicted 1348
7 SASI_Rn02_00334871 predicted 1487
8 SASI_Rn02_00334872 predicted 1312
9 SASI_Rn02_00334873 predicted 811
10 SASI_Rn02_00334874 predicted 896
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071411 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335050 predicted 1770
2 SASI_Rn02_00335051 predicted 1725
3 SASI_Rn02_00335052 predicted 1758
4 SASI_Rn02_00335053 predicted 1214
5 SASI_Rn02_00335054 predicted 1064
6 SASI_Rn02_00335055 predicted 1341
7 SASI_Rn02_00335056 predicted 1478
8 SASI_Rn02_00335057 predicted 1298
9 SASI_Rn02_00335058 predicted 1484
10 SASI_Rn02_00335059 predicted 1342
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071456 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335213 predicted 1774
2 SASI_Rn02_00335214 predicted 1724
3 SASI_Rn02_00335215 predicted 1761
4 SASI_Rn02_00335216 predicted 1219
5 SASI_Rn02_00335217 predicted 1070
6 SASI_Rn02_00335218 predicted 1338
7 SASI_Rn02_00335219 predicted 1482
8 SASI_Rn02_00335220 predicted 1307
9 SASI_Rn02_00335221 predicted 1492
10 SASI_Rn02_00335222 predicted 586
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335329 predicted 1764
2 SASI_Rn02_00335330 predicted 1721
3 SASI_Rn02_00335331 predicted 1760
4 SASI_Rn02_00335332 predicted 1213
5 SASI_Rn02_00335333 predicted 1064
6 SASI_Rn02_00335334 predicted 1340
7 SASI_Rn02_00335335 predicted 1477
8 SASI_Rn02_00335336 predicted 1303
9 SASI_Rn02_00335337 predicted 886
10 SASI_Rn02_00335338 predicted 1484
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071551 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335496 predicted 1765
2 SASI_Rn02_00335497 predicted 1724
3 SASI_Rn02_00335498 predicted 1759
4 SASI_Rn02_00335499 predicted 1215
5 SASI_Rn02_00335500 predicted 1068
6 SASI_Rn02_00335501 predicted 1339
7 SASI_Rn02_00335502 predicted 1482
8 SASI_Rn02_00335503 predicted 1299
9 SASI_Rn02_00335504 predicted 1483
10 SASI_Rn02_00335505 predicted 838
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071591 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335657 predicted 1769
2 SASI_Rn02_00335658 predicted 1721
3 SASI_Rn02_00335659 predicted 1760
4 SASI_Rn02_00335660 predicted 1218
5 SASI_Rn02_00335661 predicted 1070
6 SASI_Rn02_00335662 predicted 1334
7 SASI_Rn02_00335663 predicted 887
8 SASI_Rn02_00335664 predicted 1299
9 SASI_Rn02_00335665 predicted 861
10 SASI_Rn02_00335666 predicted 1485
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071630 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335778 predicted 1781
2 SASI_Rn02_00335779 predicted 1735
3 SASI_Rn02_00335780 predicted 1767
4 SASI_Rn02_00335781 predicted 1229
5 SASI_Rn02_00335782 predicted 1078
6 SASI_Rn02_00335783 predicted 1349
7 SASI_Rn02_00335784 predicted 1495
8 SASI_Rn02_00335785 predicted 1314
9 SASI_Rn02_00335786 predicted 1497
10 SASI_Rn02_00335787 predicted 1349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_201371 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128129 predicted 781
2 SASI_Mm01_00128130 predicted 466
3 SASI_Mm01_00128131 predicted 280
4 SASI_Mm01_00128132 predicted 595
5 SASI_Mm01_00128133 predicted 222
6 SASI_Mm01_00128134 predicted 1121
7 SASI_Mm01_00128135 predicted 436
8 SASI_Mm02_00351546 predicted 346
9 SASI_Mm01_00128137 predicted 639
10 SASI_Mm01_00128138 predicted 1190
11 SASI_Mm01_00128136 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019854
PRMT8 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 8
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019854.3-841s21c1
Sequence:CCGGGGACAACATCATCACCATATTCTCGAGAATATGGTGATGATGTTGTCCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019854.3-2007s21c1
Sequence:CCGGTGTGAGCAGCATAGTTGATATCTCGAGATATCAACTATGCTGCTCACATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019854.3-1937s21c1
Sequence:CCGGATAGCATCTTTGATAGCATAACTCGAGTTATGCTATCAAAGATGCTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019854.3-807s21c1
Sequence:CCGGACTACTCAGAGAAGATCATTACTCGAGTAATGATCTTCTCTGAGTAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-896s1c1
Sequence:CCGGGCTATCGTTCACATCTGCATTCTCGAGAATGCAGATGTGAACGATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-255s1c1
Sequence:CCGGGATTATTACTTCGACTCCTATCTCGAGATAGGAGTCGAAGTAATAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-1049s1c1
Sequence:CCGGCGTCTTCTACTTGGAAGATTACTCGAGTAATCTTCCAAGTAGAAGACGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-510s1c1
Sequence:CCGGGACAACATCATCACCATATTTCTCGAGAAATATGGTGATGATGTTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019854
PRMT8 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 8
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019854.3-841s21c1
Sequence:CCGGGGACAACATCATCACCATATTCTCGAGAATATGGTGATGATGTTGTCCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019854.3-2007s21c1
Sequence:CCGGTGTGAGCAGCATAGTTGATATCTCGAGATATCAACTATGCTGCTCACATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019854.3-1937s21c1
Sequence:CCGGATAGCATCTTTGATAGCATAACTCGAGTTATGCTATCAAAGATGCTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019854.3-807s21c1
Sequence:CCGGACTACTCAGAGAAGATCATTACTCGAGTAATGATCTTCTCTGAGTAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-896s1c1
Sequence:CCGGGCTATCGTTCACATCTGCATTCTCGAGAATGCAGATGTGAACGATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-255s1c1
Sequence:CCGGGATTATTACTTCGACTCCTATCTCGAGATAGGAGTCGAAGTAATAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-1049s1c1
Sequence:CCGGCGTCTTCTACTTGGAAGATTACTCGAGTAATCTTCCAAGTAGAAGACGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000034753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-510s1c1
Sequence:CCGGGACAACATCATCACCATATTTCTCGAGAAATATGGTGATGATGTTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019854
PRMT8 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 8
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019854.3-841s21c1
Sequence:CCGGGGACAACATCATCACCATATTCTCGAGAATATGGTGATGATGTTGTCCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358706    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019854.3-2007s21c1
Sequence:CCGGTGTGAGCAGCATAGTTGATATCTCGAGATATCAACTATGCTGCTCACATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019854.3-1937s21c1
Sequence:CCGGATAGCATCTTTGATAGCATAACTCGAGTTATGCTATCAAAGATGCTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358704    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019854.3-807s21c1
Sequence:CCGGACTACTCAGAGAAGATCATTACTCGAGTAATGATCTTCTCTGAGTAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-896s1c1
Sequence:CCGGGCTATCGTTCACATCTGCATTCTCGAGAATGCAGATGTGAACGATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-255s1c1
Sequence:CCGGGATTATTACTTCGACTCCTATCTCGAGATAGGAGTCGAAGTAATAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-1049s1c1
Sequence:CCGGCGTCTTCTACTTGGAAGATTACTCGAGTAATCTTCCAAGTAGAAGACGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000034753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019854.2-510s1c1
Sequence:CCGGGACAACATCATCACCATATTTCTCGAGAAATATGGTGATGATGTTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_201371
PRMT8 MISSION shRNA Bacterial Glycerol Stock
protein arginine methyltransferase 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000097479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201371.1-1490s1c1
Sequence:CCGGGCAGACATCTAGGACAGGTTACTCGAGTAACCTGTCCTAGATGTCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-457s1c1
Sequence:CCGGGACAATGTCATCACCATATTTCTCGAGAAATATGGTGATGACATTGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-1093s1c1
Sequence:CCGGGATTTCACAGTAGACTTGGATCTCGAGATCCAAGTCTACTGTGAAATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-280s1c1
Sequence:CCGGCGGAACTCCATGTACCATAATCTCGAGATTATGGTACATGGAGTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-1036s1c1
Sequence:CCGGGAGGAAATCTACGGGACCATACTCGAGTATGGTCCCGTAGATTTCCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_201371
PRMT8 MISSION shRNA shRNA Plasmid DNA
protein arginine methyltransferase 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000097479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201371.1-1490s1c1
Sequence:CCGGGCAGACATCTAGGACAGGTTACTCGAGTAACCTGTCCTAGATGTCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-457s1c1
Sequence:CCGGGACAATGTCATCACCATATTTCTCGAGAAATATGGTGATGACATTGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-1093s1c1
Sequence:CCGGGATTTCACAGTAGACTTGGATCTCGAGATCCAAGTCTACTGTGAAATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-280s1c1
Sequence:CCGGCGGAACTCCATGTACCATAATCTCGAGATTATGGTACATGGAGTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000097481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-1036s1c1
Sequence:CCGGGAGGAAATCTACGGGACCATACTCGAGTATGGTCCCGTAGATTTCCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_201371
PRMT8 MISSION shRNA Lentiviral Transduction Particles
protein arginine methyltransferase 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000097479    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_201371.1-1490s1c1
Sequence:CCGGGCAGACATCTAGGACAGGTTACTCGAGTAACCTGTCCTAGATGTCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097483    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-457s1c1
Sequence:CCGGGACAATGTCATCACCATATTTCTCGAGAAATATGGTGATGACATTGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-1093s1c1
Sequence:CCGGGATTTCACAGTAGACTTGGATCTCGAGATCCAAGTCTACTGTGAAATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-280s1c1
Sequence:CCGGCGGAACTCCATGTACCATAATCTCGAGATTATGGTACATGGAGTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000097481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_201371.1-1036s1c1
Sequence:CCGGGAGGAAATCTACGGGACCATACTCGAGTATGGTCCCGTAGATTTCCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)